We narrowed to 20,446 results for: REN
-
Plasmid#142879PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF2030
Plasmid#141895PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0850
Plasmid#142218PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0867
Plasmid#142209PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0038
Plasmid#142143PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1559
Plasmid#141840PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF0806
Plasmid#141711PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Utf1-KI-3'UTR-2A-tdTomato-RBGpA
Plasmid#128834PurposeKnock-in of tdTomato into mouse Utf1 locusDepositorInserttdTomato into Utf1 locus (Utf1 Mouse)
UseMouse TargetingAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF0527
Plasmid#143038PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2085
Plasmid#141914PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer5
Plasmid#138577PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17893352_17894696DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF3545
Plasmid#145021PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX Grb7-SH2
Plasmid#46444DepositorInsertGrb7 (GRB7 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 417-532PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
TFORF0849
Plasmid#141733PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
TagsRenSP (optimized renilla luciferase gene)ExpressionMammalianAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_ TET1 CXXC only
Plasmid#124084PurposeExpression of CXXC domain only form of TET1DepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX Blk-SH2
Plasmid#46407DepositorInsertBlk (BLK Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 119-224PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only