We narrowed to 25,248 results for: promoter
-
Plasmid#197505PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HF1(D10A/N497…PromoterCMV and T7Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1 YAPS127A- L318E
Plasmid#166465PurposeExpresses fusion of mEGFP and YAPS127A- L318EDepositorAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEE
Plasmid#159746PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/V5-Foxa1
Plasmid#105507PurposeMSCV-driven retroviral Foxa1 expression (V5-tagged)DepositorAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -hKCNJ2-HA tag
Plasmid#246995PurposeCan be used to generate AAV virus that will express human KCNJ2 with Ala115 HA tag from EF1α core promoterDepositorAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -hKCNJ2-V77E-HA tag
Plasmid#246996PurposeCan be used to generate AAV virus that will express human KCNJ2 V77E mutant with Ala115 HA tag from EF1α core promoterDepositorAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-FDX1
Plasmid#251696PurposeGateway-adapted FDX1 ORFDepositorInsertFDX1 ferredoxin 1 (FDX1 Human)
UseGateway donor vectorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-BCL2
Plasmid#251695PurposeGateway-adapted BCL2 ORFDepositorInsertBCL2 BCL2 apoptosis regulator (BCL2 Human)
UseGateway donor vectorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC11A2
Plasmid#251684PurposegRNA to knock out SLC11A2 in mammalian cellsDepositorInsertSLC11A2 solute carrier family 11 member 2 (SLC11A2 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC25A39-2
Plasmid#251688PurposegRNA to knock out SLC25A39 in mammalian cellsDepositorInsertSLC25A39 solute carrier family 25 member 39 (SLC25A39 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1E-1
Plasmid#251690PurposegRNA to knock out MT1E in mammalian cellsDepositorInsertMT1E metallothionein 1E (MT1E Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1E-2
Plasmid#251691PurposegRNA to knock out MT1E in mammalian cellsDepositorInsertMT1E metallothionein 1E (MT1E Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-1
Plasmid#251692PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-2
Plasmid#251693PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.Cre.IRES.dTomato
Plasmid#187192PurposeLentiviral overexpression of Cre recombinaseDepositorInsertCre recombinase (cre Escherichia phage P1 (isolate: mod749::IS5 c1.100 mutant, nat-host: Escherichia coli))
UseLentiviralAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HSE-CytoTape-V5
Plasmid#239426PurposeCytoTape signal monomer for recording HSE promoter transcriptional activityDepositorInsertCytoTape-V5 (HSPA1A Synthetic)
UseAAVTagsV5-dMBPExpressionMammalianPromoterHSPA1A promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Ub-Myc-LgBiT
Plasmid#241817PurposeExpresses Myc-tagged and LgBiT-tagged Ubiquitin for use with the Promega HiBiT systemDepositorInsertUbiquitin
TagsLgBiT and MycExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV KI Cloning Vector_hSyn mTagBFP2-CAAX2
Plasmid#236245PurposeCloning template for knock-in based strategy with U6 promoter, gRNA and donor tag cloning cassettes, and a fluorescent marker for the plasma membrane under hSyn promoterDepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only