We narrowed to 13,472 results for: sequence
-
Plasmid#127512PurposePlasmid encodes H. sapiens codon optimized Integrase 2.DepositorInsertIntegrase 2 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT9
Plasmid#127516PurposePlasmid encodes H. sapiens codon optimized Integrase 9.DepositorInsertIntegrase 9 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT13
Plasmid#127517PurposePlasmid encodes H. sapiens codon optimized Integrase 13.DepositorInsertIntegrase 13 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LV-indLS2
Plasmid#123068PurposeLentiviral construct that delivers a tamoxifen inducible Cre. Upon recombination, luc2 and mStrawberry express. Used to image spontaneous tumorigenesis or subclonal cell populations in vivo.DepositorInsertsCreERT2 with intron
Firefly luciferase
mStrawberry
UseLentiviral and Luciferase; FluorescenceExpressionMammalianMutationsynthetic intron added as indicatedPromoterCAGGS (after Cre mediated inversion) and CAGGS (f…Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9-HF1
Plasmid#126762PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-SpCas9-HF1 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than SpCas9HF1.DepositorInsertB-SpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; Q926A; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
BmR1_04g07470-bio-His
Plasmid#108037PurposeExpresses enzymatically monobiotinylated full-length BmR1_04g07470 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBmR1_04g07470
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hSOX10
Plasmid#24749DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorMutationwildtype sequenceAvailable SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
B-Sniper SpCas9
Plasmid#207361PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-Sniper SpCas9
UseCRISPRTags3xFLAGExpressionMammalianMutationF539S, M763I, K890N, amino acids 1005-1013 replac…PromoterCBhAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTQ2
Plasmid#110196PurposeEncodes for human CXCR4 coding sequence tagged with the mTQ2 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_Wild-type
Plasmid#234551PurposeHuman a-Ecat sequence/CTNNA1DepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorInsertPEMax Delta RNAseH
TagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 FS1
Plasmid#113955Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, one base pair dele…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-ABE8e
Plasmid#206882PurposeExpresses FLAG-tagged ABE8e fused to Gag through a linker sequenceDepositorInsertABE8e
UseCRISPR and LentiviralTagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-LSSmOrange
Plasmid#110197PurposeEncodes for human CXCR4 coding sequence tagged with the LSS-mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAP03-sp44/p21
Plasmid#120232PurposeCarries bidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites that can be amplified with homology sequence for refactoring.DepositorInsertbidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites
UseSynthetic BiologyMutationaac(3)IV (apramycin resistance gene)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only