We narrowed to 25,824 results for: Nov
-
Plasmid#124161PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-1beta
Plasmid#124156PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
ExpressionBacterial and MammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Aurora_CA_Citrine
Plasmid#98219PurposeSlow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with green light, inactivation max with 625 nm (accelarates closure to ms). Not recommended for in vivo use. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora_C128A gene
UseAAVTagsCitrineExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, C128A, P24…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 E2F1 Flag(Δ193-359) (HindIII- BamHI- EcoRI)
Plasmid#70667PurposeHuman mutant of E2F1 lacking amino acids 193-359DepositorInsertE2F1 lacking residues 193 to 359 (E2F1 Human)
TagsFLAGExpressionMammalianMutationlacks amino acids 193-359PromotercmvAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCOG40-HRS (257-276) Hs
Plasmid#83236PurposepGST-HRS (257-276) Hs, Expresses the GST-HRS in E.coliDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF4D03
Plasmid#70969PurposeGateway entry cloneDepositorInsertTaf12 (Taf12 Fly)
UseGateway entry vectorAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only