We narrowed to 78,902 results for: son
-
Plasmid#134359PurposeNanoluc complementation assay. Expression of Gαi3 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi3. Addition of the HA epitope at N terminus of Gαi3.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pUC19-hAPOE-R-loop
Plasmid#134901PurposeGeneration and purification of R-loops for in vitro biochemistryDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICE-FLAG-NAT10-siR-WT
Plasmid#59365PurposePlasmid for constitutive or doxycycline-inducible expression of wild-type human NAT10 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInserthuman NAT10 (NAT10 Human)
TagsFLAGExpressionMammalianMutationMutations to render cDNA resistant to a siRNAPromoterCMV-tetAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi2-LgB91
Plasmid#134358PurposeNanoluc complementation assay. Expression of Gαi2 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi2. Addition of the HA epitope at N terminus of Gαi2.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas13-inactive M3nls
Plasmid#157854PurposeTargeted m6A RNA methylation in mammalian cells, methyltransferase-inactive mutantDepositorInsertdCas13-inactive dCas13-inactive M3nls (METTL3 Cas13b is from Prevotella sp. P5-125; METTL3 is from H. sapiens)
ExpressionMammalianMutationPspCas13b Δ984-1090 H133A; METTL3 D395AAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSin-EF2-Oct4-Pur
Plasmid#16579DepositorInsertHomo sapiens POU domain, class 5, transcription factor 1 (POU5F1) (POU5F1 Human)
UseLentiviralExpressionMammalianAvailable SinceJan. 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSIN4-CMV-K2M
Plasmid#21164DepositorArticleAvailable SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-KRAB-PGK-HygR
Plasmid#83890PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.DepositorInsertshumanized dead Cas9 KRAB
aminoglycoside phosphotransferase from E. coli
UseCRISPR and LentiviralTagsFlagMutationD10A and H840APromoterHuman Ubiquitin C Promoter and mouse phosphoglyce…Available SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTag-RFP-C-h-Rab11a
Plasmid#79806PurposeExpress TagRFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
U6-DNMT1-hSynapsin-PE2-Nterminal-P2A-EGFP-KASH-lenti
Plasmid#135955PurposeNeuronal expression of N-terminal intein-split prime editor v2 (PE2) with EGFP-KASH marker and U6-mDNMT1 cassette. This plasmid is used by PE2, PE3, and PE3bDepositorInsertPrime editor v2 (PE2) N-terminal
UseLentiviralExpressionMammalianPromoterhSynapsinAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/BLM
Plasmid#111766PurposeTo express human BLM protein in human cellsDepositorInsertBLM (BLM Human)
TagsFlag epitope tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys…ExpressionMammalianPromoterCMVAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP_Rab35 Q67L active
Plasmid#47425DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Cep152
Plasmid#136825PurposeMammalian expression of the centrosomal protein Cep152 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep152 (CEP152 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS2115
Plasmid#49140PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP-WPRE
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRK5-myc-Miro1 E208K/E328K
Plasmid#47894PurposeExpresses myc tagged Miro1 E208K/E328K mutantDepositorInsertMiro1 E208K/E328K (RHOT1 Human)
TagsmycExpressionMammalianMutationE208K/E328K, abolishes calcium bindingPromoterCMVAvailable SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICE-FLAG-NAT10-siR-G641E
Plasmid#59366PurposePlasmid for constitutive or doxycycline-inducible expression of G641E mutant of human NAT10 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertNAT10 NM_024662 (NAT10 Human)
TagsFLAGExpressionMammalianMutationG641E and silent mutations to render the cDNA res…PromoterCMV-tetAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.D2-NP
Plasmid#134366PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.DepositorInsertD2-NP (DRD2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCS4 3XFLAG-PPARgamma2
Plasmid#78770PurposeTo overexpress PPARgamma2 in Mammalian CellsDepositorAvailable SinceJune 10, 2016AvailabilityAcademic Institutions and Nonprofits only