We narrowed to 18,471 results for: gateway
-
-
-
-
-
-
9336-E07
Plasmid#234302PurposeGateway ORF Entry clone of human TGFBR1 NDN to A with stop codon (for native or N-terminal fusions)DepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
8522-E08
Plasmid#234293PurposeGateway ORF Entry clone of mouse Tgfbr1 with stop codon (for native or N-terminal fusions); N/267A/D269A/N270A mutationsDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E05
Plasmid#234300PurposeGateway ORF Entry clone of human Tgfbr1 with stop codon (for native or N-terminal fusions); T204D mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E06
Plasmid#234301PurposeGateway ORF Entry clone of human TGFBR1 with stop codon (for native or N-terminal fusions); K232R mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR/hBIG1
Plasmid#226251PurposeEntry plasmid of hBIG1 for Gateway systemDepositorInsertBIG1 (ARFGEF1 Human)
UseEntry vectorAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorInsertets2 (ets2 Zebrafish)
UseGateway entry vectorMutationN189D (rs502796915); S231NPromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
R777-E338 Hs.STK3-nostop
Plasmid#70622PurposeGateway ORF clone of human STK3 [NM_006281.3] without stop codon (for C-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only