We narrowed to 14,055 results for: crispr grnas
-
Plasmid#124862PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1821_pCR8-SMN2-DN-RG6-SA
Plasmid#118655PurposeTransient transfection; Expressed DR-SMN2-DN-RG6-SA-DR CasRx polycistronic gRNA with 3 spacers targeting SMN2 intron and 1 spacer targeting RG6 splice acceptor; Gateway DonorDepositorInsertSMN2-DN-RG6-SA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC-crRNA-Km
Plasmid#158712PurposePlasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells and a non-targeting crRNADepositorInsertAcGFP (for crRNA cloning)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterTetOAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141A2.0
Plasmid#99896PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pV1435
Plasmid#111439PurposeSolo vector pV1382 + sgCgADE2DepositorInsertCaCas9/sgCgADE2
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pV1329
Plasmid#111438PurposeSolo vector pV1326 +sgCgADE2DepositorInsertCaCas9/sgCgADE2
UseCRISPRExpressionYeastAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141C2.0
Plasmid#99905PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-M
Plasmid#242203PurposeOsU6-2p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in monocots.DepositorInsertLevel1 OsU6-2p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterOsU6-2pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-M
Plasmid#242204PurposeOsU6-2p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in monocots.DepositorInsertLevel1 OsU6-2p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterOsU6-2pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-D
Plasmid#242205PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9B_arr2
Plasmid#149572Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneExpressionBacterialPromoterPflaB, PpQE30Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only