We narrowed to 26,103 results for: lars;
-
Plasmid#216457PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth30
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM031_P4_tSynth29
Plasmid#216456PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth29
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM030_P4_tSynth27
Plasmid#216455PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth27
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM029_P4_tSynth25
Plasmid#216454PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth25
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM028_P4_tSynth3
Plasmid#216453PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM027_P4_tSynthGuo
Plasmid#216452PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator guo
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM025_P2_pTUP11
Plasmid#216450PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tup11
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM023_P2_pAPL4
Plasmid#216448PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter apl4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM021_P2_pTUB1
Plasmid#216446PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tub1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM018_P2_pRPL701
Plasmid#216443PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rpl701
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM017_P2_pTIF51
Plasmid#216442PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tif51
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM016_P2_pRPL2501
Plasmid#216441PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rpl2501
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT87
Plasmid#204489PurposeCAG promoted WBeta recombinaseDepositorInsertWBeta recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCAGAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-TREER
Plasmid#208321PurposeBacterial expression of the His-tagged peptide TREER.DepositorInsertTREER
TagsDBCO-Tag, His-TagExpressionBacterialAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
IAA17-4flag-HIS5
Plasmid#207015PurposeFor ORF tagging with IAA17-4Flag. IAA17 is an auxin-inducible degron (AID).DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only