We narrowed to 10,073 results for: CAG
-
Plasmid#210509Purposeexpresses PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP component in rat hippocampal neuron cellsDepositorInsertsTagsMycExpressionMammalianPromoterhSynAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Scramble
Plasmid#250237PurposeCre-dependent AAV expressing mCherry and a scrambled shRNA under EF1α promoter. Used as a non-targeting control for shRNA knockdownDepositorInsertshRNA-Scramble (SMARCA4 Synthetic)
UseAAV, Cre/Lox, Mouse Targeting, RNAi, and Syntheti…ExpressionMammalianPromoterEF1αAvailable sinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT22UbGfpnE4PCh(#301)
Plasmid#184066Purposecyclofen-inducible GFP nuclear relocation in zebrafish permanent transgenicDepositorInserteGFP-nls-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-hGCN5mut
Plasmid#103828PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorExpressionMammalianMutationhGCN5: A566G (E189G), G585T (K195N), G726A (silen…PromoterCMVAvailable sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 TL
Plasmid#188150PurposeExpresses C-terminal flag-tagged human CAD hCPS1 TL in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only