We narrowed to 44,513 results for: INA
-
Plasmid#171566PurposeBacterial expression of HA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-HA-His)DepositorInsertNb127D01-HA-His (CXCR2 Human)
TagsHA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-mTert
Plasmid#162555PurposeOverexpression of TertDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pW17
Plasmid#158207Purpose2lox landing pad plasmid with mariner transposon and transposase used for CRAGEDepositorInsertloxP/Cre/KmR/Lox5171/Mariner IR oriT/transposase
Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
ppyCAG_RNaseH1_WKKD
Plasmid#111905PurposeExpress WKKD mutated RNASEH1 in mammalian cell. The combination of three specific mutations (W43A, K59A, K60A) in the binding domain prevents the enzyme from binding to RNA/DNA hybridsDepositorInsertRNASEH1 (RNASEH1 Human)
TagsV5ExpressionMammalianMutationChanged D 210 to N, W 43 to A, K 59 to A, K 60 to…Available SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-6xHis [N144/14R]
Plasmid#177500PurposeMammalian Expression Plasmid of anti-6xHis. Derived from hybridoma N144/14.DepositorInsertanti-6xHis recombinant mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc-LATS2
Plasmid#66852PurposeExpress Myc-tagged LATS2 in mammalian cellsDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertVillin-mTQ2-P2A-FlpO-ERT2
TagsmTQ2, linked to FlpO through an P2A ribosomal ski…ExpressionMammalianPromoterVillinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/td5StayGold(c4)=GianCreg
Plasmid#212022PurposeFor labeling the Golgi apparatus. c4 is the appendage for N-terminal tagging with td5StayGold. ‘GianCreg’ is an abbreviation for giantin C-terminal region. ‘=’ denotes a linker [(GGGGS)3].DepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVC-FUS-WT
Plasmid#175066Purposeexpresses mVenus and mCherry tagged to FUS wildtype in mammalian cellsDepositorInsertFUS glycine rich protein (FUS Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-eGFP-hcGAS
Plasmid#108674PurposeFor production of retrovirus and transduction of mammalian cells, allowing expression of N-terminally eGFP-tagged human cGASDepositorAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTRClover
Plasmid#59151PurposeLentiviral vector to express JNK KTR mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (MAPK8 Human, Mouse)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330_CDC45
Plasmid#244243PurposeExpresses SpCas9 and a sgRNA targeting the human CDC45 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
anti-GFP scFv [N86/38] with sortase tag
Plasmid#204419PurposeMammalian Expression of anti-GFP scFv with a sortase tag for direct dye conjugation. Derived from hybridoma N86/38.DepositorInsertRecombinant mouse scFv targeting GFP (Aequorea victoria)
Tags6xHis tag and Sortase tagExpressionMammalianAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A(K188R)-2A-mCherry
Plasmid#177166PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Lysine at position 188 substituted with Arginine.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationChanged Lysine 188 to ArgininePromoterCMV with beta globin intronAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb5-flag
Plasmid#86769PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 5 (PSMB5 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
ExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28-his-3C_Tau352
Plasmid#100092PurposeExpresses human full-length fetal tau protein with the N-terminal 3C-cleavable His6 tagDepositorInsertFetal microtubule-associated protein tau (MAPT Human)
TagsHis6ExpressionBacterialMutationwild type sequencePromoterT7Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX 4T-1 GST-Ago2 S387A
Plasmid#60656PurposeExpresses GST-Ago2 S387A mutant in mammalian cellsDepositorAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMG024 MBP-GSK3β-HA-His, GST_λPPase
Plasmid#196182PurposeCo-expresses MBP-GSK3β-HA-His (human GSK3β as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β-HA-HisDepositorAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only