We narrowed to 33,995 results for: eng
-
Plasmid#205534PurposeExpress mCherry-MS2x2 (export tag consisting of 2 tandem repeats of MS2 stem-loop aptamer)DepositorInsertmCherry
ExpressionMammalianMutationWTPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
Integrin-β6 I domain I270C
Plasmid#159639PurposeContains integrin beta 6 residues 108–352 with I270C mutationDepositorInsertIntegrin beta 6 I domain I270C
Tags6x HisExpressionMammalianMutationI270CAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP_LD 0_TEV
Plasmid#58877PurposeMESA protease chain with Rapamycin FKBP ectodomain and no linker domainDepositorInsertMESA protease chain with FKBP rapamycin-binding ectodomain, TEV protease and mCherry fusion
UseAAVTagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
FnR8-10
Plasmid#182569PurposeHuman fibronectin fragment, type-III repeats 8-10, R1379A mutantDepositorInsertHuman fibronectin fragment, type-III repeats 8-10
TagsHis and TEV cleavage site after His tagExpressionBacterialMutationR1379AAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-LexAOx4-Pmin-mCherry
Plasmid#192633PurposeLentiviral vector for inducible mCherry expression.DepositorInsertmCherry
UseLentiviralExpressionMammalianPromoterMinimal promoterAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB8787
Plasmid#126921PurposePlasmid containing integration cassette at IntD1 integration site in Yarrowia lipolytica for overexpression of HMG1DepositorInsertHMG1
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-G418
Plasmid#236481PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on G418.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLITMUS-rpoN-cI-J23106-geneIII
Plasmid#80843PurposePhagemid (encodes M13 gene III and lambda cIopt).DepositorInsertsM13 gene III
Lambda cI
ExpressionBacterialPromoterBBa_J23106 and rpoNAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB8788
Plasmid#126922PurposePlasmid containing integration cassette at IntD1 integration site in Yarrowia lipolytica for overexpression of XdCrtI and HMG1DepositorInsertXdCrtI and HMG1
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUM
Plasmid#133130PurposeA recombinant plasmid expressing fum (fumarase) geneDepositorInsertfumarase gene
ExpressionBacterialPromoterPEP-carboxykinase promoterAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAX APP C60
Plasmid#30152DepositorInsertAmyloid Precursor Protein C60
ExpressionMammalianMutationfragmentAvailable SinceAug. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pZ8-P_dCas9
Plasmid#74063PurposepZ8-1 plasmid carrying dcas9 driven by the propionate-inducible prpD2 promoter (PprpD2), KanRDepositorInsertdcas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPropionate inducible promoter (prp)Available SinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
OA-986B
Plasmid#124999PurposeExpresses dCas9-VPR driven by the Ubiquitin-63E promoterDepositorInsertdCas9-VPR
UsePiggybackExpressionInsectPromoterUbiquitinAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-AsCas12f-WT
Plasmid#204635PurposeExpression of wild-type AsCas12f in mammalian cellsDepositorInsertAsCas12f
TagsNLSExpressionMammalianPromoterCMVAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB8748
Plasmid#126918PurposePlasmid containing integration cassette at IntE1 integration site in Yarrowia lipolytica for overexpression of XdCrtEDepositorInsertXdCrtE
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR_EF1a-->Gss52SR4-LaM4-P2A-NLSIFP
Plasmid#162229PurposeLentiviral vector for the expression of Gss52SR4-LaM4-P2A-NLSIFP in mammalian cellsDepositorInsertLaG17 GFP nanobody SynNotch tTA
UseLentiviralExpressionMammalianAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only