We narrowed to 10,676 results for: yeast
-
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxamEXP4CUP1
Plasmid#218284PurposeUse together with pJE13HD7 and pJE13HD7 derivatives to integrate RelE expression cassette under the control of the CUP1 promoter at ho locusDepositorInsertHph>tAgTEF1-ISceI-Repeat2-pCUP1>RelE(1-125)>RPL28intron>RelE(126, 289)>tTPI1-HO(1828, 1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4QE2Crimson
Plasmid#218280PurposeIntroduction of a bicistronic expression cassette of yEGFP and E2Crimson under the control of the SkGAL2 promoterDepositorInsertpURA3>KlURA3>tKlURA3-pSkGAL2>yEGFP>ERBV1.2A>E2Crimson>tURA3
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL4A
Plasmid#218277PurposeIntroduction of a LowTempGAL Turbo module (GAL4) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-fcy1(454-778)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPAP_scFv_V50A
Plasmid#183734PurposeExpresses anti-lysozyme scFv antibody with V50A mutation on MFalpha signalDepositorInsertAnti-lysozyme scFv
TagsHis6-tagExpressionYeastMutationV50A mutation in MFalpha signalPromoterAOX1 promoterAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC5-toxic3
Plasmid#188625PurposepSC5GGv2 with HindII Gene InsertDepositorInsertHindII
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationACT1 intron insertAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
M2C5
Plasmid#188606PurposeMinimal Conjugative Plasmid 2DepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
M1C1
Plasmid#188609PurposeMinimal Conjugative Plasmid 1DepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (M)
Plasmid#182435PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96W-N127W) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (G)
Plasmid#182477PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96C) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-mRuby2
Plasmid#176550PurposeExpression of mRuby2 for auxotrophic selection in the absence of methionineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-mWasabi
Plasmid#176552PurposeExpression of mWasabi for auxotrophic selection in the absence of leucineDepositorInsertmWasabi
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-eCFP
Plasmid#176558PurposeExpression of eCFP for auxotrophic selection in the absence of methionineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-TagRFP657
Plasmid#176560PurposeExpression of TagRFP657 for auxotrophic selection in the absence of lysineDepositorInsertTagRFP657
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only