We narrowed to 18,121 results for: STO;
-
Plasmid#222299PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK3 and FHIP1B) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionBacterialAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pBIG1a_StrepII-Hook3[451-718]_FTS_FHIP1B
Plasmid#222300PurposeCo-expresses truncated human FHF (FTS, StrepII-HOOK3[451-718] and FHIP1B) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook3[571-718]_FTS_FHIP1B
Plasmid#222301PurposeCo-expresses truncated human FHF (FTS, StrepII-HOOK3[571-718] and FHIP1B) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseMutationVariant 2 is chr10:128569418-T-C where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGMC00027
Plasmid#199279PurposeSpCas9 construct to knockout murine Cd274DepositorAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSUMO mouse ZNG1-METAP1 fusion
Plasmid#197398PurposeExpresses a SUMO-tagged fusion of ZNG1, residues 10-30 and mouse METAP1, residues 1-59DepositorAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-inducible 3xFlag Mouse C325A Caspase-9 ΔA LS
Plasmid#194926PurposeInducible Expression of N-Terminal 3X Flag Mouse C325A Caspase-9 Minus Large Subunit Region Val 177 to Arg 263DepositorInsertN-Terminal 3X Flag Mouse C325A Caspase-9 Minus Sequence Encoding Val 177 to Arg 263 (Casp9 Mouse)
Tags3X FlagExpressionMammalianMutationChanged Cysteine 325 to Alanine to Eliminate Prot…PromoterCMVAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-inducible 3xFlag Mouse C325A Caspase-9 ΔLD + ΔSS
Plasmid#194610PurposeInducible Expression of N-Terminal 3X Flag Mouse C325A Caspase-9 Minus Linker + Small Subunit DomainDepositorInsertN-terminal 3X Flag Mouse C325A Caspase-9 Minus Sequence Encoding Ala 354 to Ser 454 (Casp9 Mouse)
Tags3X FlagExpressionMammalianMutationChanged Cysteine 325 to Alanine to eliminate prot…PromoterCMVAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-DnaJB1(H33Q)-PKAcat-mCherry
Plasmid#181854PurposemCherry-tagged DnaJB1-PKA catalytic subunit fusion with H33Q DnaJB1 mutation to block Hsp70 binding; for mammalian expression.DepositorTagsmCherryExpressionMammalianMutationHistidine 33 in DnaJB1 changed to glutamine.PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mclover-YTH-IDR2
Plasmid#177122PurposeBacterial expression of YTH-IDR2 fragment of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH and IDR2 domains) (YTHDC1 Human)
TagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH and IDR2 domains only (IDR1 deletion)PromoterT7Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-PuroR [M1G]
Plasmid#171803PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-BlastR [M1G]
Plasmid#171808PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-BlastR [M1G]
Plasmid#171807PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-gB-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-BlastR [M1G]
Plasmid#171806PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-PuroR [M1G]
Plasmid#171804PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only