We narrowed to 17,921 results for: por
-
Plasmid#221597PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with RVEP4A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363-KRN-3A-GFP
Plasmid#221598PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with KRN-3A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC-IRES-Blasti
Plasmid#242462PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_G198R
Plasmid#242465PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199R
Plasmid#242466PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199G
Plasmid#242467PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199G mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_ANK3-4
Plasmid#242468PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The ANK3-4 mutations disrupt XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationANK3-4 = R87A - E95A - K96A - W124G - K128GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-CMV-myc-XPO1_H10-11
Plasmid#242471PurposeExpresses human XPO1 protein with an N-terminal cMyc tag. The H10-11 mutations disrupt ASB8 binding.DepositorInsertXPO1 (XPO1 Human)
TagscMycExpressionMammalianMutationXPO1 H10-11 = E478A - H481A - V484G - N485G - T48…PromoterCMVAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-Tag100-hASB8_G198R
Plasmid#242461PurposeExpresses human ASB8 protein with an N-terminal Tag100 along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTagsTag100ExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti
Plasmid#242463PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker. The K7R mutations prevent ubiquitin chain elongation.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitRatioGFP:LAAQ
Plasmid#240451PurposeExpression of indicator protein fusion (modified ratiometric pHluorin & low affinity Aequorin) for monitoring calcium concentrations and pH in cell walls of higher plants. See Resource Information.DepositorInsertFusion of chitinase signal, soluble modified ratiometric pHluorin and low affinity Aequorin (D119A)
ExpressionBacterial and PlantMutationRatiometric GFP (ratiometric pHluorin) (PMID 9671…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GSDMD_H270A
Plasmid#224701PurposeExpression of mutated Gasdermin D_H270A (GSDMD_H270A) in transfected mammalian cell linesDepositorAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-GSDMD_Q29A
Plasmid#224702PurposeExpression of mutated Gasdermin D_Q29A (GSDMD_Q29A) in transfected mammalian cell linesDepositorAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-GSDMD_Q29A_H270A
Plasmid#224703PurposeExpression of mutant Gasdermin D_Q29A_H270A (GSDMD_Q29A_H270A) in transfected mammalian cell linesDepositorInsertGSDMD_Q29A_H270A (GSDMD Human)
TagsFLAGExpressionMammalianMutationQ29A and H270APromoterCMVAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-GSDMD_D275A
Plasmid#224704PurposeExpression of mutated Gasdermin D_D275A (GSDMD_D275A) in transfected mammalian cell linesDepositorAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-GSDMD_H270A_D275A
Plasmid#224705PurposeExpression of mutated Gasdermin D_H270A_D275A (GSDMD_D275A) in transfected mammalian cell linesDepositorInsertGSDMD_Q29A_H270A (GSDMD Human)
TagsFLAGExpressionMammalianMutationH270A and D275APromoterCMVAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTK41
Plasmid#236110PurposeExpresses the motor domain of rat KIF5C fused with SNAP tag and ALFA tag nanobodyDepositorInsertsTagsALFA tag nanobody, His tag, SNAP tag, and StrepII…ExpressionBacterialMutationC7S mutation is introduced. 1-430 aa is encoded.PromoterT7Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only