We narrowed to 10,976 results for: esp
-
Plasmid#222900PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114DepositorInsertFKBP-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2375-FKBP-GPA-20-11S
Plasmid#222897PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFKBP-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2376-FKBP-GPA-20-114
Plasmid#222896PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFKBP-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2378-FRB-GPA(V84R)-20-11S
Plasmid#222899PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc11S
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2377-FRB-GPA(V84R)-20-114
Plasmid#222898PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2085-WT-GPA-NLuc-Biosensor-Retrovirus-TD135
Plasmid#222875PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(WT)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2132-FKBP-GPA-114-5-CyOFP1
Plasmid#222891PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2127-FRB-GPA-114-20-CyOFP1
Plasmid#222886PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2129-FRB-GPA-114-5-CyOFP1
Plasmid#222888PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2128-FRB-GPA-114-10-CyOFP1
Plasmid#222887PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2131-FKBP-GPA-114-10-CyOFP1
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1
Plasmid#159531PurposeExpresses Arabidopsis thaliana VERNALIZATION1 in E. coliDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71102
Plasmid#154065PurposeLevel 0 Golden Gate vector; Unmodifed CREDepositorInsertCRE
UseSynthetic Biology; Standard cloning vector used b…MutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 N184X
Plasmid#92373PurposeInducible expression of M87 N184X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, N184XPromoterTet-responsive P tightAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP S245X with 5'UTR
Plasmid#92376PurposeInducible expression of S245X spastin M1 and M87 in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 S245X
Plasmid#92374PurposeInducible expression of M87 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, S245XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M1 S245X
Plasmid#92372PurposeInducible expression of M1S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, S245XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M1 N184X
Plasmid#92371PurposeInducible expression of M1 N184X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, N184XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only