We narrowed to 42,217 results for: Kin
-
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223-TAF5-∆ex8_WobbleMut
Plasmid#209054PurposeGateway-compatible entry vector, with insert of the TAF5 isoform lacking the alternative exon-8 (∆ex8) mutated to be resistant to TAF5 siRNADepositorInsertTAF5 deltaexon-8
UseGateway entry vectorExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_Dual_GST-TEV-EGFP-TBK1ΔCTD (res 1-666)
Plasmid#198072PurposeUsed for the expression and purification of EGFP labelled TBK1 carrying a mutation for the removal of the CTD (SMC Internal No. 1874)DepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10-FERM-ITGBD
Plasmid#194855PurposeExpress EGFP-MYO10 with mutations (S2001_F2002insA/T2009D) that interfere with ITGB binding in mammalian cells.DepositorInsertMYO10 S2001_F2002insA/T2009D (MYO10 Human)
TagsEGFPExpressionMammalianMutationMYO10 has the following mutations S2001_F2002insA…PromoterCMVAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_PM
Plasmid#177759PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iDianiSnFR_ER
Plasmid#177758PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iDianiSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_PM
Plasmid#177755PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_PM
Plasmid#177753PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_PM
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCytSnFR_ER
Plasmid#177752PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCytSnFR_ER
UseAAVPromoterhSynAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iDianiSnFR_PM
Plasmid#177751PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpCMV(MinDis)-iDianiSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iDianiSnFR_ER
Plasmid#177750PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpCMV(MinDis)-iDianiSnFR_ER
ExpressionMammalianPromoterhCMVAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iCyt_BrEt_SnFR_PM
Plasmid#177747PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpCMV(MinDis)-iCyt_BrEt_SnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
_pCMV(MinDis)-iCyt_F_SnFR_PM
Plasmid#177745PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsert_pCMV(MinDis)-iCyt_F_SnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iCytSnFR_PM
Plasmid#177743PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpCMV(MinDis)-iCytSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn iCyt_BrEt_SnFR_ER
Plasmid#177756PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn iCyt_BrEt_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iCyt_F_SnFR_ER
Plasmid#177754PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpAAV9-hSyn-iCyt_F_SnFR_ER
UseAAVPromoterhSynAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iCyt_BrEt_SnFR_ER
Plasmid#177746PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertpCMV(MinDis)-iCyt_BrEt_SnFR_ER
ExpressionMammalianPromoterhCMVAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only