We narrowed to 32,154 results for: LIS;
-
Plasmid#104058PurposeAAV expression of Cre-dependent reporter mRuby2DepositorInsertmRuby2
UseAAVPromoterCAGAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMan operon
Plasmid#124888PurposeExpresses proteins encoding Man operon in E. faecalisDepositorInsertmanX1, manX2, manY, manZ, manO, EF0025
ExpressionBacterialAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG-D-mSpyCatcher-His6-E
Plasmid#87376PurposeAn ORF part-containing vector harbouring the minimal SpyCatcher (ΔN1ΔC22) sequence with a His6 tag at its C-terminus and 4 bp overhangs specific for the ‘downstream SpyPart’ position within an ORF assDepositorInsertmSpyCatcher
UseSynthetic BiologyTagsHis6 tagAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEPMS0CM0026
Plasmid#227519PurposeL0 part - CDS (without STOP codon)DepositorInsertCoMAS (Calendula officinalis mixed-amyrin synthase)
ExpressionPlantMutationBsaI sites removed by silent mutationAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL0-MjcDOPA5GT
Plasmid#162530PurposeMirabilis jalapa cyclo-DOPA 5-O-glucosyltransferase coding sequence in pICH41308 MoClo Golden Gate level 0 acceptor for CDS1 modules.DepositorInsertcDOPA5GT
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH825-CEN-minRLuc/slowstaCFLuc
Plasmid#115370PurposeExpresses translation elongation-controlled Renilla luciferase and translation initiation-controlled firefly luciferaseDepositorInsertsGcn4 5'-UTR + Firefly Luciferase
Renilla luciferase (codon minimised)
ExpressionYeastMutationAll codons have been changed for the least favour…PromoterADH1 and TDH3Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MBP-2xNLS-tdTomato
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-GFP
Plasmid#104061PurposeAAV expression of nuclear localized GFP with SV40 NLSDepositorHas ServiceAAV PHP.eBInsertGFP
UseAAVPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC-CANTHipi
Plasmid#53301PurposeContains crtE, idi, crtI, crtY, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and a crtO cDNA of Haematococcus pluvialis fused to a Trc promoter. Produces canthaxanthin in E. coli.DepositorInsertcrtO
UseLow copy number bacterial cloning vectorTags6HisPromoterTrcAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP
Plasmid#117383PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFPDepositorHas ServiceAAV1InsertEYFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-2xNLS-mTurquoise2
Plasmid#118025PurposeAn AAV genome that expresses nuclear localized mTurquoise2 from the hSyn1 promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterhSyn1Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-2xNLS-mTurquoise2
Plasmid#104053PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein mTurquoise2 from the GFAP promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterGFAPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLGB36
Plasmid#135621PurposeSuicide vector for allelic replacement in Bacteroides species including B. fragilis strain 638R, erythromycin selection and aTC-inducible ss-Bfe3 counterselectionDepositorInsertbfe3
UseBacteroides suicide vector with inducible counter…Tagssignal sequence for periplasmic targetingPromoterBacteroides promoter regualted by TetR transcript…Available SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
0_T7-mScarlet3
Plasmid#225927PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 (control)DepositorInsertmScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-GNL
Plasmid#204499PurposeExpresses Glis1, Nanog and lin28a by tet-on promoter in mammalian cellsDepositorInsertGlis1 (Glis1 Mouse)
ExpressionMammalianAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only