We narrowed to 29,136 results for: promoter
-
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_ZFP64_Delta_TAD
Plasmid#118698PurposeExpress ZFP64 without transcription activation domain(TAD)DepositorInsertZFP64_Delta_TAD (ZFP64 Human)
UseLentiviralTags3XFLAG was fused to the N terminal of ZFP64 cDNAMutationDelete amino acid from 453 to 681Available SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDT2:GUS
Plasmid#108444PurposeArabidopsis transformation, expresses HDT2 promoter/GUS fusion to study expression pattern in rootsDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S828E
Plasmid#91999PurposeExpresses FLAG-HA-AGO2 (S824E-S828E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S831E
Plasmid#92000PurposeExpresses FLAG-HA-AGO2 (S824E-S831E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S828E-S831E
Plasmid#92001PurposeExpresses FLAG-HA-AGO2 (S828E-S831E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S828E-S831E
Plasmid#92002PurposeExpresses FLAG-HA-AGO2 (S824E-S828E-S831E)DepositorInsertAGO2 (AGO2 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationS824E, S828E, S831EAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824A-T830A
Plasmid#92003PurposeExpresses FLAG-HA-AGO2 (S824A-T830A)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-FLL[157-159]AAA
Plasmid#96994PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-N[80]A
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-FLL[157-159]AAA
Plasmid#96991PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-N[80]A
Plasmid#96992PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/mutE2F(-69)-like
Plasmid#66743Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationGCG (-69,-68,-67) to ATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-PIAL2M-sim1
Plasmid#67908PurposeInducible expression of a mutant of PIAL2M where the SIM interacting motif 1 (VFDL 425-428) was substituted with alanines.DepositorInsertPIAL2 (AT5G41580 Mustard Weed)
TagsMBPExpressionBacterialMutationE281-A496; VEDL 425-428 AAAPromoterP-lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (mut - miR-21 site1)
Plasmid#62580PurposeTranslational Luciferase Reporter encoding a mutated fragment of the SPRED1 3'UTR. The upstream miR-21 (site 1) binding site was mutated.DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseMutationmiR-21 binding site 1 mutant (TAAGCTA --> TAGA…Available SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only