We narrowed to 18,028 results for: URE
-
Plasmid#136009PurposeS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-EGFP
Plasmid#132974Purposegata2a endothelial enhancer (x6) and basal promoter driving egfp in pTol1 backboneDepositorInsertseGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3_mTq-Tat (c-plasmid)
Plasmid#127635PurposeEncodes a fluorecent protein with an RNA binding peptide: mTurquoise2-tat.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme PlmJ and RBS BBa_B0034.DepositorInsertmTurquoise2
UseSynthetic BiologyTagsRNA binding peptide: PCP and RNA binding peptide:…ExpressionBacterialAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLL2
Plasmid#132531PurposeHuman LC8-2, codon optimised for Sf9 expression.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLT3
Plasmid#132532PurposeHuman TCTEX-3, codon optimised for Sf9 expression.DepositorAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLRB2
Plasmid#132534PurposeHuman Rbl-2, codon optimised for Sf9 expression.DepositorAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFP-RIP2_3K
Plasmid#131205Purposemammalian expression, tet RDepositorInsertRIPK2 K209/410/538R (RIPK2 Human)
TagsEGFPExpressionMammalianMutationK209/410/538RPromoterpCMVAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMJA105
Plasmid#128521PurposeExpresses amyloid human Lysozyme in Pichia pastorisDepositorAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-Cdc45 (delta 154–164)
Plasmid#126879PurposeExpresses crystallisation construct of human Cdc45 in bacteriaDepositorInsertHuman Cdc45 (CDC45 Human)
TagsNo tagExpressionBacterialMutationdeletion amino acid 154-164PromoterT7 promoterAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 d835
Plasmid#113959Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-834PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSD_SpCas9MT2-NLS-3xHA-NLS-SaCas9WT-2xNLS
Plasmid#107321PurposeExpresses SpCas9 (R1333S) fused to SaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1333S) is fused to SaCas9PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRExpressionBacterialPromoterS. pyogenes Cas9 native promoterAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 P294A
Plasmid#112102PurposeMammalian expression of GFP-tagged Dynamin protein.DepositorAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only