We narrowed to 6,900 results for: mcherry
-
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPnpr-4Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPflp-18Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sg-1
Plasmid#190607PurposeExpresses a gRNA for base editing the EGFP Kozak sequence of pWPT-/mEGFP-1T-IRES-mCherryDepositorInsertgRNA sequence
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACE-GIRK2-mC-S
Plasmid#172428PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag IIDepositorAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianMutationPromoterAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only