We narrowed to 17,254 results for: REV
-
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 R3 W
Plasmid#231876PurposeBacterial expression of N-terminally 6His tagged Gcn4 R3 WDepositorInsertGcn4 R3 W
Tags6xHis, TEV cleavage siteExpressionBacterialMutationD103R, N126W, D133R, K143RPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 L123A+
Plasmid#231869PurposeBacterial expression of N-terminally 6His tagged Gcn4 L123A+DepositorInsertGcn4 L123A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123APromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTrGCsgScLEU2
Plasmid#224869PurposeDisruption of S. cerevisiae type LEU2 genesDepositorAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgScLEU2
Plasmid#224868PurposeDisruption of S. cerevisiae type LEU2 geneDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
BS-ZJLEU-PTEF1-GFP
Plasmid#207018PurposeOver-expression of GFP under TEF1 promoter, use auxotrophic marker LEU2(Saccharomyces cerevisiae).DepositorInsertGFP
ExpressionYeastPromoterpTEF1Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ypq2-2GFP-URA
Plasmid#207010PurposeIntegration of 2xGFP tag at YPQ2 C terminus, use auxotrophic marker URA3(Kluyveromyces lactis) for selection. Marker for yeast vacuolar membrane.DepositorInsertYPQ2
Tags2xGFPExpressionYeastAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Vph1-2GFP-URA
Plasmid#207009PurposeIntegration of 2xGFP tag at VPH1 C terminus, use auxotrophic marker URA3(Kluyveromyces lactis) for selection. Marker for yeast vacuolar membrane.DepositorInsertVPH1
Tags2xGFPExpressionYeastAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRH3105
Plasmid#210164PurposeProtein quality control substrate and associated control YIp ADE2-LEU2 pTDH3::lys1-P194Q-GFP::tADH1DepositorInsertYIp ADE2-LEU2 pTDH3::lys1-P194Q-GFP::tADH1 (LYS1 Budding Yeast)
ExpressionYeastMutationP194QAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only