We narrowed to 2,589 results for: GCG
-
Plasmid#197356PurposeA knock-out vector for dog ErbB3.DepositorInsertA gRNA targeting the dog ERBB3 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 1
Plasmid#193586PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 1 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-T#2
Plasmid#171516Purposedeletion of a genomic locus in T(Brachyury) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L1-#2
Plasmid#171504Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L2-#2
Plasmid#171506Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-ex1-#1
Plasmid#171507Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-Target2 (Mpphot)
Plasmid#186729PurposeBinary vector for CRISPR/Cas9 (target 2: Mpphot [negative control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQB
Plasmid#164991PurposeExpression of gRNA targeting HLA-DQB locus, including DQB1*05:01:01DepositorInsertgRNA against HLA-DQB1*05:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-H3.1 (Hist1h3g) sgRNA
Plasmid#186930PurposeHist1h3g sgRNA used for genomic targeting at Hist1h3g C-terminalDepositorAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV51
Plasmid#188484PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056D
Plasmid#183132PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii bTub, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056E
Plasmid#183133PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii dsx, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[dsx]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056F
Plasmid#183134PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[tra]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RARA
Plasmid#183318PurposeAll-in-One CRISPRko system with a guide RNA that targets RARA geneDepositorInsertRARA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K2
Plasmid#183309PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K2 geneDepositorInsertMAP2K2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK6
Plasmid#183276PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK6 geneDepositorInsertCDK6
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only