We narrowed to 13,991 results for: RING;
-
Plasmid#178686PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, seven Tyr …PromoterAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-20G+20S+7F-7Y
Plasmid#178688PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-20G+20S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty Gly residues replaced with Ser, seven Tyr …PromoterAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-14N-4Q+18G
Plasmid#178694PurposeBacterial expression of N-terminally 6His tagged A1-LCD with fourteen Gln residues removed, four Asn removed, replaced with eighteen Gly (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-14N-4Q+18G (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationfourteen Gln residues removed, four Asn removed, …PromoterAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-20G+20S-12F+12Y
Plasmid#178689PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty Gly residues replaced with Ser, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-20G+20S-12F+12Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty Gly residues replaced with Ser, twelve Phe…PromoterAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+23G-23S-12F+12Y
Plasmid#178691PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty-three Ser residues replaced with Gly, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+23G-23S-12F+12Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty-three Ser residues replaced with Gly, twel…PromoterAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+23G-23S+7F-7Y
Plasmid#178690PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty-three Ser residues replaced with Gly, seven Tyr replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+23G-23S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty-three Ser residues replaced with Gly, seve…PromoterAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7V51G-VA
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7H126A-VA
Plasmid#115185PurposeLentiviral transduction and expression of PARK7H126A into any mammalian cellDepositorInsertPARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationp.H126APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7E163K-VA
Plasmid#115186PurposeLentiviral transduction and expression of PARK7E163K into any mammalian cellDepositorInsertPARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationp.E163KPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNB1-LOX
Plasmid#154058PurposeLevel 1, Position 3 Golden Gate vector. ZmUbi-5'UTR:loxP-GUS-nosT-loxP-NAM-B1-nosTDepositorInsertLoxP-flanked GUS and TtNAM-B1
UseSynthetic BiologyTagsExpressionBacterialMutationThe TtNAM-B1 gene sequence was domesticated to re…PromoterZmUbiAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-VAR
Plasmid#128509PurposeLentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorInsertRAB5IF (RAB5IF Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTO_CHMP4B_LAP
Plasmid#101850PurposeTet-inducible expression of human CHMP4B with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertCharged Multivesicular Body Protein 4B (CHMP4B Human)
UseGateway cloning, flp-frt recombination, tet-induc…TagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianMutationPromoterCMVAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTO_CHMP2B_LAP
Plasmid#101848PurposeTet-inducible expression of human CHMP2B with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertCHMP2B (CHMP2B Human)
UseFlp-frt recombination, tet-inducible expressionTagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianMutationsilent mutation in Thr 104; A to TPromoterCMVAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsmEos2ExpressionMammalianMutationPromoterAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-SUMO-Rab10 Q68L
Plasmid#236720PurposeExpresses Rab10 Q68L with His tag and SUMO cleavage sequenceDepositorArticleAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only