We narrowed to 48,575 results for: eng
-
Plasmid#106373Purposecreating stable line with GFP and G418 resistanceDepositorInserteGFP and geneticin/G418 resistance gene
UseRetroviralExpressionMammalianAvailable SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-3-F37A+L196F+V252A+C253G-hADPRM
Plasmid#107163PurposeExpresses specific cyclic-ADP-ribose (cADPR) phosphohydrolase in Escherichia coli as a GST fusion protein that can be cut with PreScission(TM) protease to yield active enzymeDepositorInsertF37A+L196F+V252A+C253G-hADPRM GST-mutant cADPR phosphohydrolase gene
TagsGSTExpressionBacterialPromotertacAvailable SinceMarch 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-YOD1-MutS2-C160S
Plasmid#85668PurposeExpression of human YOD1 I292Q V295Q C160S mutant with N-terminal GFP tagDepositorInsertYOD1 (YOD1 Human)
TagsGFPExpressionMammalianMutationC160S and I292Q and V295QPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:EDLL:tNos (GB1190)
Plasmid#75404PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the EDLL Transcriptional ActivatorDepositorInsertdCas:EDLL
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAR69_STRI_m(KS_MAT)_H8_pET22b
Plasmid#122849PurposeExpresses the condensing part of murine type I fatty acid synthase (FASN) consisting of the KS and MAT domain in Escherichia coli. N-terminal Twin-Strep tag; C-terminal H8-tag; in pET22b vector.DepositorInsertm(KS_MAT) (Fasn Mouse)
TagsHis8 tag and Twin-Strep tagExpressionBacterialMutationwildtypePromoterT7 promoterAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-Fc-His
Plasmid#72068PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-SVOP [N356/23R]
Plasmid#114499PurposeMammalian Expression Plasmid of anti-SVOP (Rat). Derived from hybridoma N356/23.DepositorInsertanti-SVOP (Rattus norvegicus) recombinant mouse monoclonal antibody (Svop Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Islr-AP-His
Plasmid#71950PurposeExpresses the entire Islr protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG30 IQGAP1 3'UTR mut
Plasmid#14504DepositorInsertIQGAP1 3'UTR mutant (IQGAP1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationGTGCCTT was changed to GTGCGCC and GTGCCT was cha…Available SinceMarch 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
CRAF_S29A_pcDNA3.1
Plasmid#86506PurposeExpresses CRAF_S29A in mammalian cells [Edit]DepositorAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-FHF-A [N235/22R]
Plasmid#114509PurposeMammalian Expression Plasmid of anti-Pan-FHF-A (Human). Derived from hybridoma N235/22.DepositorInsertanti-Pan-FHF-A (Homo sapiens) recombinant mouse monoclonal antibody
ExpressionMammalianPromoterdual CMVAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-EMX1 gRNA (SpyCas9 scaffold)
Plasmid#113040PurposeAAV vector; encodes GFP as well as a U6-driven EMX1-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA EMX1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [2_n-1] (GB1206)
Plasmid#75407PurposetRNA and scaffold for the assembly of GBoligomers for the intermediate position (positon [2_n-1]) of a polycistronic tRNA-gRNA (3-part multiplexing)DepositorInserttRNA-gRNA position [2_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
L1cam-AP-His
Plasmid#71957PurposeExpresses the extracellular region of the L1CAM protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIDx-ID-1058
Plasmid#135347PurposeExpression of intradomain insertion of truncated human cytosine deaminase, hAIDx, at position 1058 of nSpyCas9 with uracil DNA glycosylase inhibitor (UGI) at the C terminusDepositorInsertnSpyCas9-hAIDx-ID-1058-UGI
UseCRISPRExpressionMammalianMutationWTAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mqg*
Plasmid#21175DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 6163 (numbering acco…Available SinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*
Plasmid#21172DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 5114 (numbering acco…Available SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAN19-3xFLAG-TIR1-NOSt
Plasmid#108545PurposeCloning vector including N-terminally 3xFLAG-tagged Arabidopsis auxin receptor TIR1 [Wild type] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with 3xFLAG and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTags3xFLAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only