We narrowed to 14,283 results for: cas9
-
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
px335-EF-Slc2a3-L
Plasmid#122304PurposeExpresses sgRNA targeting mouse Slc2a3 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Slc2a3 (Slc2a3 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
sgMAPKAP1_1
Plasmid#124912PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZ002
Plasmid#120231PurposeCRISPR-cas9 targeting in E. coli with ampicillin resistanceDepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pADH100-2
Plasmid#90981PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH99 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, FRT, DS_HIS1
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chr8q_Centromere-Targeting_gRNA
Plasmid#195128PurposegRNA targeting centromere-proximal location on Chromosome 8q in a third generation Cas9 backbone with GFPDepositorInsertChr8q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-N
Plasmid#190336PurposeExpressing the N-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, ngRNA and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-N, ngRNA and pegRNA for PCSK9 +1A insertion
UseAAVAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Nematode, Synthetic)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pR26-mBMP7
Plasmid#127374PurposeAllows for doxycycline-inducible BMP7 expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorInsertBMP7 (Bmp7 Mouse)
UseCRISPR and Mouse TargetingAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Julianna (split-vector)
Pooled Library#247028PurposeEnriched for effective guides through prioritization of guides with strong on-target activity. Designed against current gene annotations, offering coverage of the contemporary mouse genome.DepositorHas ServiceLentiviral PrepExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-APIC-H840A
Plasmid#250797PurposeDrosophila transgenic vector: Gateway cloning destination vector for expressing enhancer driven Cas9-derived nickase H840A.DepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-APIC-D10A
Plasmid#250796PurposeDrosophila transgenic vector: Gateway cloning destination vector for expressing enhancer driven Cas9-derived nickase D10A.DepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTopo RE2 Donor pLox hPGK-Puro pA pLox
Plasmid#171049PurposeDonor template for CRISPR/Cas9 targeting of TERT RE2DepositorInsertPuromycin
UseCre/LoxExpressionMammalianAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTopo RE3 Donor pLox hPGK-Puro pA pLox
Plasmid#171050PurposeDonor template for CRISPR/Cas9 targeting of TERT RE3DepositorInsertPuromycin
UseCre/LoxExpressionMammalianAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only