We narrowed to 14,572 results for: cas9 genes
-
Plasmid#86130PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 1 targeting C1orf27 (C1orf27 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-2
Plasmid#86131PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 2 targeting C1orf27 (C1orf27 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrActin-UBI
Plasmid#226709PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrActin promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrActin
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pY094
Plasmid#84743PurposeExpresses huAsCpf1-T2A-GFP and crRNA guideDepositorInsertshuAsCpf1
GFP
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only