We narrowed to 41,178 results for: KAN;
-
Plasmid#116876Purposestable TCR expression in human T cellsDepositorUseLentiviralExpressionMammalianPromoterEF1-alphaAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pMJA285= pSin-TCRab-CMVp-Puro
Plasmid#116875Purposestable TCR expression in human T cellsDepositorUseLentiviralExpressionMammalianMutationdeletion of EF1-a promotorPromoterCMV PromotorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
ML2
Bacterial Strain#61906PurposeC43(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. ilvE gene deleted.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
ML6
Bacterial Strain#61908PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. ilvE, avtA genes deleted.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Zinc Finger Consortium Expression Vector and Modular Assembly Kit
Plasmid Kit#1000000005PurposePlasmids and strain to assemble Zinc finger nucleases (ZFNs) for performing genome engineering in a variety of organisms.DepositorApplicationGenome EditingVector TypeBacterial Expression, Insect Expression, Mammalian Expression, Plant ExpressionEditing TypeZFNAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
RP1B FUS 1-163
Plasmid#127192PurposeProtein expression for affinity purificationDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR wt-FLAG
Plasmid#204532PurposeMammalian expression of human CALR wt-FLAGDepositorInsertCALR wt-FLAG (CALR Human)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL-HA
Plasmid#204530PurposeMammalian expression of human MPL-HADepositorInsertMPL-HA (MPL Human)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL-V5
Plasmid#204531PurposeMammalian expression of human MPL-V5DepositorInsertMPL-V5 (MPL Human)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only