We narrowed to 18,028 results for: URE
-
Plasmid#97005PurposeExpresses LEMD2-mCherry in mammalian cells under a crippled promoterDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-PE2-P2A-GFP
Plasmid#132776PurposePrime editing in mammalian cells with co-translational GFP expressionDepositorInsertPE2-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG RpH-LAMP1-3xFLAG
Plasmid#163018Purposeexpresses ratiometric sensor of lysosomal lumenal pHDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
T7_CC_PE7_IVT_Template
Plasmid#223022PurposeTemplate for in vitro transcription of PE7. For HSPC-related experiments.DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSPromoterT7Available SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvFLAG
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCold-I-Dsup
Plasmid#90021PurposeTo express His-tagged Dsup in bacteriaDepositorInsertDsup
TagsHisExpressionBacterialPromotercspAAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-mNeonGreen-BRD4
Plasmid#204692PurposeThis plasmid allows for inducible expression of short BRD4 isoform tagged with mNeonGreen, in mammalian cells.DepositorAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-FLAG-SF3B1-WT
Plasmid#82576PurposeExpresses a codon-optimized ORF of human SF3B1 (wild-type)DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry N1 MFN2
Plasmid#157759PurposeExpression of MFN2:mcherry in cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cilantro 2
Plasmid#74450PurposeCan clone in a C2H2 zinc finger via BsmBI restriction sites and monitor post-translational degradation using EGFP:mCherry ratio (Lentiviral, PGK.BsmBICloneSite-EGFP.IRES.mCherry.cppt.EF1a.PuroR)DepositorTypeEmpty backboneUseLentiviralTagsEGFPAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA
Plasmid#183776PurposeAAV genome with a CAG driven Cre recombinase with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertCre
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-Cre
Plasmid#121675PurposeExpresses Cre recombinase and HA tag in a Flp dependent fashion (fDIO)DepositorHas ServiceAAV Retrograde, AAV1, AAV5, AAV8, and AAV9InsertNLS-CRE-HA
UseAAVTags3xHA and SV40-NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
IF-GFP-ATRX
Plasmid#45444PurposeATRX expression vectorDepositorInsertATRX (ATRX Human, Mouse)
TagsGFP and HAExpressionBacterial and MammalianMutationisoform 2, missing codon E124PromoterPCMVAvailable SinceMay 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-mCherry-IRES-Cre
Plasmid#55632PurposeExpresses Cre in Mammalian CellsDepositorHas ServiceAAV Retrograde and AAV8InsertsmCherry
Cre
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only