We narrowed to 60,628 results for: tra
-
Plasmid#143476PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF3513
Plasmid#144989PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1838
Plasmid#142865PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1659
Plasmid#141862PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0879
Plasmid#143236PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 HA-ECL2 (NT931)
Plasmid#49063PurposeExpresses human NKCC1 mutant with HA tag inserted into extracellular loop #2 and an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutation2xHA epitope in ECL2 inserted at aa398 in hNKCC1 …PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBiex1-SYNAC
Plasmid#82710PurposeSynthetic soluble adenylyl cyclase FRET sensor and cAMP generatorDepositorTagsFLAG, mCerulean, and mCitrineExpressionBacterial and InsectPromoterT7Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF3316
Plasmid#144792PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCVD313
Plasmid#159771PurposeExpression vector for mutated Fc-fused ACE2(740)DepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF3218
Plasmid#144694PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-PLXNB2-shRNA2
Plasmid#98400PurposeLentivirus for expression of shRNA2 against human PLEXIN-B2 (Dox-inducible)DepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
GP805
Plasmid#164545PurposeExpresses Smo-FLAG K348, 360, 434, 444, 448, 543, 565, 568, 569, 575, 579, 628, 671, 676, 677, 678, 681, 682, 683, 684, 717RDepositorInsertSmoothened K348, 360, 434, 444, 448, 543, 565, 568, 569, 575, 579, 628, 671, 676, 677, 678, 681, 682, 683, 684, 717R (Smo Mouse)
UseLentiviralTagsFLAGMutationAll 21 cytoplamic Lysines of Smoothened changed t…PromoterGgCryD1Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 HA-ECL3 (NT933)
Plasmid#49064PurposeExpresses human NKCC1 mutant with HA tag inserted into extracellular loop #3 and N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutation2xHA epitope in ECL3 inserted at aa460 in hNKCC1 …PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBabe 3XFLAG-S37A-GATA6-3XAU1 puro
Plasmid#72608PurposeFor mammalian expression of an N-terminally triple FLAG-tagged and C-terminally triple AU1-tagged full length human GATA6 with a single serine#37 to alanine mutationDepositorInsertGATA binding protein 6 (GATA6 Human)
UseRetroviralTags3XAU1 and 3XFLAGExpressionMammalianMutationchanged serine37 to alanineAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBabe_LYSET_isoform2
Plasmid#246081PurposeStable expression of LYSET isoform 2 (short isoform)DepositorAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe_LYSET_isoform1
Plasmid#246080PurposeStable expression of LYSET isoform 1 (long isoform)DepositorAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Egr1-CytoTape-V5
Plasmid#239428PurposeCytoTape signal monomer for recording Egr1 promoter transcriptional activityDepositorInsertCytoTape-V5 (EGR1 Synthetic)
UseAAVTagsV5-dMBPExpressionMammalianPromoterEgr1 promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits