We narrowed to 20,498 results for: ACE
-
Plasmid#162786PurposeThe extracellular domain of Angiotensin converting enzyme 2 (ACE2) expressionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTags10xHis, FLAG, and hTPA leaderExpressionMammalianMutationPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTracer-EF-mFxh
Plasmid#21927DepositorAvailable SinceAug. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
MAC-ACE2
Plasmid#158381PurposeMAC-tagged gene expressionDepositorAvailable SinceAug. 25, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pmCellFree_KA1_Human-ACE2
Plasmid#169406PurposeCell-free/mammalian expression vector for Human ACE2 receptor with N-term eGFPDepositorInsertHuman ACE2 receptor (ACE2 Human)
UseCell-free expression vectorTagsHis and eGFPExpressionMutationPromoterT7- CMV/CAGAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v1
Plasmid#145148PurposeMammalian expression plasmid for soluble ACE2 (protease domain) high affinity variant 1DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-NEDD1
Plasmid#178073PurposeInsect cell expression of NEDD1DepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Histone Deacetylase 5
Plasmid#21626DepositorAvailable SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
HACE1_L (OZ565)
Plasmid#33379DepositorInsertZinc finger array targeting HACE1 (LOC572430 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable SinceJan. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
HACE1_R (OZ566)
Plasmid#33380DepositorInsertZinc finger array targeting HACE1 (LOC572430 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable SinceJan. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pME_G_0_3_001_5'UTR_placeholder
Plasmid#235830PurposeEncodes a sfGFP cassette in the 5'UTR position used for placeholder cloningDepositorInsert5'UTR placeholder
UseSynthetic BiologyTagsExpressionMutationnonePromoterAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C4
Plasmid#240608PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 4 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C1
Plasmid#240604PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 1 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C(3+4)
Plasmid#240611PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 3 and Cluster 4 of ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on both ACE2…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C(0+4)
Plasmid#240610PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 0 and Cluster 4 of ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on both ACE2…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C0
Plasmid#240603PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 0 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C3
Plasmid#240607PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 3 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_G_0_5_001_3'UTR_Placeholder
Plasmid#235905PurposeEncodes a sfGFP cassette in the 3'UTR position used for placeholder cloningDepositorInsert3'UTR placeholder
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1-Pacer
Plasmid#216698PurposeMammalian expression of PacerDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTFG027_Spike_sACE2-resistant_D614G_F486S_3xFlag
Plasmid#191572PurposeMutated SARS-CoV-2 Spike under CMV with D614G, C-term 19 amino acid truncation, and 3x FLAG. Encodes F486S mutation. For expression and pseudotyping lentiviral particles.DepositorInsertSARS-CoV-2 Spike Protein (S Synthetic)
UseTags3x FLAGExpressionMammalianMutationD614G and F486S (confers reduced binding affinity…PromoterCMVAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only