We narrowed to 40,986 results for: KAN
-
Plasmid#187396Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pMSCV-IRES-GFP/CALR del52-FLAG
Plasmid#204523PurposeRetroviral expression of human CALR del52-FLAGDepositorAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR wt-FLAG
Plasmid#204525PurposeRetroviral expression of human CALR wt-FLAGDepositorInsertCALR wt-FLAG (CALR Human)
UseRetroviralAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR ins5-FLAG
Plasmid#204524PurposeRetroviral expression of human CALR ins5-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
RP1B FUS 1-163 S12xQ
Plasmid#127193PurposeProtein expression for affinity purificationDepositorInsertFUS 1-163 S12xQ (FUS Human)
TagshexahistidineExpressionBacterialMutationS12xQ: S30Q, S44Q, S48Q, S53Q, S70Q, S84Q, S89Q, …Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RP1B FUS 1-163 QQ4xSS #1
Plasmid#127194PurposeProtein expression for affinity purificationDepositorInsertFUS 1-163 QQ4xSS #1 (FUS Human)
TagshexahistidineExpressionBacterialMutationQQ4xSS #1: Q27S, Q28S, Q93S, Q94S, Q132S, Q133S, …Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RP1B FUS 1-163 QQ4xSS #2
Plasmid#127195PurposeProtein expression for affinity purificationDepositorInsertFUS 1-163 QQ4xSS #2 (FUS Human)
TagshexahistidineExpressionBacterialMutationQQ4xSS #2:Q8S, Q9S, Q60S, Q62S, Q102, Q103, Q139S…Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA4
Plasmid#204529PurposeLentiviral expression of MPL-shRNA4; gene knock down of human MPLDepositorInsertMPL-shRNA4 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA3
Plasmid#204528PurposeLentiviral expression of MPL-shRNA3; gene knock down of human MPLDepositorInsertMPL-shRNA3 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA2
Plasmid#204527PurposeLentiviral expression of MPL-shRNA2; gene knock down of human MPLDepositorInsertMPL-shRNA2 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA1
Plasmid#204526PurposeLentiviral expression of MPL-shRNA1; gene knock down of human MPLDepositorInsertMPL-shRNA1 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del18-197)-FLAG
Plasmid#204539PurposeMammalian expression of human CALR ins5 (del18-197)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del198-430)-FLAG
Plasmid#204538PurposeMammalian expression of human CALR ins5 (del198-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del367-430)-FLAG
Plasmid#204536PurposeMammalian expression of human CALR ins5 (del367-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR ins5 (del309-430)-FLAG
Plasmid#204537PurposeMammalian expression of human CALR ins5 (del309-430)-FLAGDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only