We narrowed to 1,897 results for: sfGFP
-
Plasmid#196399Purposeexpresses CRISPR Cascade Type IC target sequence for in vivo assayDepositorInserttype IC dsDNA target
ExpressionBacterialPromoterT7Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.mArid3a.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#169318PurposeDoxycycline-inducible expression of murine Arid3a cDNA with dTomato as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pminiTol2-5xUAS-hsp-sfGFP-zP2A-tetoff-zN2cG-zP2A-zTVA (UGNT-A)
Plasmid#240272PurposeHelper plasmid for zebrafish rabies virus based-circuit tracingDepositorInsertsN2cG (codon-optimized for Danio rerio)
sfGFP (codon-optimized for Danio rerio)
TVA (codon-optimized for Danio rerio)
tetoff (codon-optimized for Danio rerio)
UseZebrafish expressionAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
Cx43K258stop-msfGFP
Plasmid#69023PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
TagsV206K monomerized super folder GFPExpressionMammalianMutationdelete codons 258-381 and fuse in frame to monome…PromoterCMVAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPS0381
Plasmid#133231PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter PsNifH (pOGG043), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-SunTag
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pASPIre3
Plasmid#154844PurposeDerivative of pASPIre2 lacking mCherry but containing a silent 150 bp DNA spacer flanked by attB/P sites; main uASPIre plasmid used in this studyDepositorInsertBxb1-sfGFP fusion controlled by rhamnose-inducible promoter; attB/attP-flanked silent discriminator
ExpressionBacterialAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7
Plasmid#180315Purposemammalian expression of human SEPT7 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cx30-msfGFP
Plasmid#69019PurposeExpresses human Cx30 (GJB6 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRC072
Plasmid#225982PurposeJ23110_buj_sfGFP_buj_mRFPDepositorInsertsfGFP (with buj RBS), mRFP (with buj RBS)
ExpressionBacterialPromoterJ23110Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPS0383
Plasmid#133233PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJH776_pJH_LldR_PlldR-sfGFP.3opal
Plasmid#163735PurposeLactate-inducible expression of green fluorescent protein encoding three opal codonsDepositorInsertlldr gfp.3TGA
ExpressionBacterialMutationgfp with first three leucine codons mutated to am…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH807_pJH_LldR_Pcon-sfGFP.2TAG
Plasmid#163738PurposeConstitutive expression of green fluorescent protein encoding two stop codonsDepositorInsertlldr gfp.2TAG
ExpressionBacterialMutationgfp.N39TAG,Y135TAGAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH809_pJH_LldR_Pcon-sfGFP.10TAG
Plasmid#163739PurposeConstitutive expression of green fluorescent protein encoding ten stop codonsDepositorInsertlldr gfp.10TAG
ExpressionBacterialMutationgfp with first 10 leucine codons mutated to amberAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH27_pBad_AraC_Para-sfGFP.2TAG
Plasmid#163722PurposeArabinose-inducible expression of green fluorescent protein encoding two amber codonsDepositorInsertaraC gfp.2TAG
ExpressionBacterialMutationgfp.N39TAG,Y151TAGAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH628_pJH_LldR_PlldR-sfGFP.3TAG
Plasmid#163727PurposeLactate-inducible expression of green fluorescent protein encoding three amber codonsDepositorInsertlldr gfp.3TAG
ExpressionBacterialMutationgfp.N39TAG,N135TAG,Y151TAGAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH726_pJH_LldR_PlldR-sfGFP.15TAG
Plasmid#163730PurposeLactate-inducible expression of green fluorescent protein encoding fifteen amber codonsDepositorInsertlldr gfp.15TAG
ExpressionBacterialMutationgfp with first 15 leucine codons mutated to amberAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH25_pBad_AraC_Para-sfGFP.0TAG
Plasmid#163720PurposeArabinose-inducible expression of green fluorescent protein encoding zero amber codonsDepositorInsertaraC gfp
ExpressionBacterialAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-125b-2.PGK.sfGFP.P2A.Tet3G
Plasmid#169315PurposeDoxycycline-inducible expression of miR-125b-2 with dTomato as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only