We narrowed to 10,264 results for: Uty

#185705

CMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLS

Raul Perez-Jimenez

Alonso-Lerma et al Nat Microbiol. 2023 Jan;8(1):77-90. doi:

June 7, 2022

Academic Institutions and Nonprofits only

#185703

CMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLS

Raul Perez-Jimenez

Alonso-Lerma et al Nat Microbiol. 2023 Jan;8(1):77-90. doi:

June 7, 2022

Academic Institutions and Nonprofits only

#185704

CMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLS

Raul Perez-Jimenez

Alonso-Lerma et al Nat Microbiol. 2023 Jan;8(1):77-90. doi:

June 7, 2022

Academic Institutions and Nonprofits only

#185702

CMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLS

Raul Perez-Jimenez

Alonso-Lerma et al Nat Microbiol. 2023 Jan;8(1):77-90. doi:

June 7, 2022

Academic Institutions and Nonprofits only

#177865

Cloning Backbone for NanoLuc-luciferase-based EXSISERS containing FRT-sites flanked PuroR cassette

Gil Westmeyer

Truong et al Nat Cell Biol. 2021 Jun;23(6):652-663. d

April 8, 2022

Academic Institutions and Nonprofits only

#177867

Cloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassette

Gil Westmeyer

Truong et al Nat Cell Biol. 2021 Jun;23(6):652-663. d

April 8, 2022

Academic Institutions and Nonprofits only

#177869

Cloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).

Gil Westmeyer

Truong et al Nat Cell Biol. 2021 Jun;23(6):652-663. d

April 8, 2022

Academic Institutions and Nonprofits only

#162497

Expresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a is inserted between GFP and Tac(5A).

Lei Lu

Sun et al J Biol Chem. 2020 Aug 21. pii: RA120.014

Jan. 29, 2021

Academic Institutions and Nonprofits only

#158790

pcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioID

Benjamin Blencowe

Gonatopoulos-Pournatzis et al Mol Cell. 2020 Mar 19;77(6):1176-1192.e1

Sept. 9, 2020

Academic Institutions and Nonprofits only

#110320

TRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Aug. 20, 2018

Academic Institutions and Nonprofits only