We narrowed to 10,264 results for: Uty
-
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_NLuc_FRT-PuroR
Plasmid#177865PurposeCloning Backbone for NanoLuc-luciferase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertNLuc-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_BSD_FRT-PuroR
Plasmid#177867PurposeCloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertBSD-based EXSISERS
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_SurfaceHaloTag_FRT-PuroR
Plasmid#177869PurposeCloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).DepositorInsertSurface-HaloTag-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Cstem-Tac(5A)
Plasmid#162497PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a is inserted between GFP and Tac(5A).DepositorTagsGFPExpressionMammalianMutationThe five threonine residues are mutated into alan…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 rtTA BirA eIF4G +MIC
Plasmid#158790PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1 (with microexon)
Tags3xFlag and BirA*ExpressionMammalianPromoterminiCMVAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only