We narrowed to 55,801 results for: plasmid
-
Plasmid#233054PurposeTo express Flag-tagged Rat Arc from a TRE3g promoter. The Arc gene contains the Rat Arc 3'UTR containing NO intronsDepositorInsertRat Arc
UseAAVTagsFlagAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS1_NSP13_BV_NBIO-TEV_CTHROM-his
Plasmid#234382PurposeBaculovirus expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp13_SARS
UseBaculovirus expresssionTagsLVPRGSGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGPromoterPolyhedrinAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_DDX25
Plasmid#232359PurposeEnhancer near DDX25, chr11:125935511-125936012 cloned into pGL3DepositorInsertDDX25 (DDX25 Human)
UseLuciferaseAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_bothneg0scramble
Plasmid#232383PurposeMSR1 enhancer, both buffering Coordinators scrambledDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZP05
Plasmid#232319PurposepZP05 was constructed by cloning the oriFn-repA fragment from pCWU6 into the smaller suicide plasmid pCM-galK, facilitating replication in Fusobacterium nucleatumDepositorInsertOri-repA
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-H2BC11
Plasmid#227588PurposeLentiviral plasmid expressing human H2BC11 proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_gutB
Plasmid#212139PurposeCargo plasmid for integrating PT7 expression cassette of xylitol dehydrogenase in in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertxylitol dehydrogenase
ExpressionBacterialPromoterPT7Available SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCT03
Plasmid#212150PurposePlasmid expressing alanine dehydrogenase under inducible promoter PT7 control. The enzyme is thermophilic and works best at 50 C.DepositorInsertalanine dehydrogenase
Tags6x HisExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SynCAM4/pCDNA3
Plasmid#197328PurposePlasmid expressing an antigen targeting NECL4/SynCAM4DepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTNA-c200
Plasmid#205114PurposePTN protein expressionDepositorAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only