We narrowed to 1,427 results for: PTS;
-
Plasmid#245722PurposeExpress Flag-HA-hnRNPC in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRK5R DD-FAM98B[1-330]
Plasmid#211358PurposeTransient expression of DD-V5-FAM98B[1-330]DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRNA scPhe-GAA
Plasmid#211359PurposeTransient expression of scPhe-GAADepositorInsertS. cerevisiae Phe-GAA tRNA
ExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJJB1462
Plasmid#218623PurposeExpress mKate-TEV_cutSite_YFP to the peroxisome with low expression TEV proteaseDepositorInsertYFP
TagsePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1463
Plasmid#218624PurposeExpress mKate-TEV_cutSite_YFP to the peroxisome with high expression TEV proteaseDepositorInsertYFP
TagsePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKOet-Peroxisomes-2
Plasmid#54534PurposeLocalization: Peroxisomes, Excitation: 548, Emission: 561DepositorInsertmKO-Peroxisomes
TagsPeroxisomal Targeting Signal 1 (PTS1; Ser-Lys-Leu…ExpressionMammalianAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Strep-Halo
Plasmid#219682PurposeMammalian expression of Strep-HaloTag fusion proteinDepositorInsertStrepTag-HaloTag
ExpressionMammalianPromoterCMV & T7Available SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1426
Plasmid#218622PurposeExpress tNCS to the peroxisome for toxicity assayDepositorInserttNCS
TagsYFP-ePTS1ExpressionYeastMutation106-588Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB207
Plasmid#218596PurposeExpress degron assay: Degradation tag-YFP-ePTS1DepositorInsertYFP
TagsUbiY degradation tag and ePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-MCS-3AID-HA-2A-mTurquoiseBSD
Plasmid#225704PurposeEmpty backbone for lentiviral expression of AID degron tagged POI and mTurquoise fused BlasticidinRDepositorTypeEmpty backboneUseLentiviral and Synthetic BiologyTagsT2A-mTurquoiseExpressionMammalianPromoterpEF1AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsAGO4_F
Plasmid#146317PurposeMammalian Expression of HsAGO4DepositorInsertHsAGO4 (AGO4 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2Katushka-ter-Hygromycin
Plasmid#184772PurposeRed marker for yeast late Golgi/early endosome. Integration of 2xKatushka tag at SEC7 C terminus. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_591
Plasmid#160653PurposeExpresses OLE1 under the control of the yeast Sup35 promoterDepositorAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJPL3[flp-6p::cmk-1::GFP]
Plasmid#124613PurposeUsed to confirm the expression of the trans-spliced GFP reporter in the expected ASE neuronsDepositorInsert[flp-6p::cmk-1::GFP]
ExpressionWormAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PA RdgC_pET21a
Plasmid#14927DepositorInsertRecombination-associated protein rdgC
TagsHisExpressionBacterialAvailable SinceJune 29, 2007AvailabilityAcademic Institutions and Nonprofits only -
OM14-2EGFP-UG74-ter
Plasmid#184758PurposeMarker for yeast mitochondria. Integration of 2xGFP tag at OM14 C terminus. Uses antibiotic resistance marker natMX6.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2EGFP-ter-NAT
Plasmid#184764PurposeMarker for yeast late Golgi/early endosome . Integration of 2xGFP tag at SEC7 C terminus. Uses antibiotic resistance marker natMX6.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACH1-2EGFP-ter-URA3
Plasmid#184769PurposeMarker for yeast mitochondria. Integration of 2xGFP tag at ACH1 C terminus. Uses auxotrophic marker URA3(Candida albicans).DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only