We narrowed to 4,564 results for: ARA-2
-
Plasmid#84224PurposeDisturb the expression of miR528 in riceDepositorInsertmiR528
ExpressionBacterial, Plant, and Yeast…Promoter2x35SAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Osa-pCAMBIA-1301-STTM529
Plasmid#84225PurposeDisturb the expression of miR529 in riceDepositorInsertmiR529
ExpressionBacterial, Plant, and Yeast…Promoter2x35SAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gma-pCAMBIA-1301-STTM396
Plasmid#84081PurposeDisturb the expression of miR396 in soybeanDepositorInsertmiR396
ExpressionBacterial, Plant, and Yeast…Promoter2x35SAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gma-pCAMBIA-1301-STTM408
Plasmid#84082PurposeDisturb the expression of miR408 in soybeanDepositorInsertmiR408
ExpressionBacterial, Plant, and Yeast…Promoter2x35SAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Osa-pCAMBIA-1301-STTM397
Plasmid#84207PurposeDisturb the expression of miR397 in riceDepositorInsertmiR397
ExpressionBacterial, Plant, and Yeast…Promoter2x35SAvailable SinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVH004
Plasmid#80401PurposeContains pBAD-CusR and pCusR-antiscaffold with no fluorescent protein. Used as a control for autofluorescence.DepositorUseSynthetic BiologyTagsC-terminal LZx domainExpressionBacterialAvailable SinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVH015
Plasmid#80398PurposeContains pBAD-CusR (response regulator) and pCusR-antiscaffold-GFP(3xFLAG). Used for Western blotsDepositorUseSynthetic BiologyTagsC-terminal 3xFLAG tag and C-terminal LZx domainExpressionBacterialAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
COVID-SARS2 NSP14/10
Plasmid#159613PurposeBacterial co-expression vector fo Covid-SARS2 NSP14 and NSP10DepositorInsertsTagsHis6, TEV cleavage site and noneExpressionBacterialMutationCodon-optimized for E. coli expressionPromoter(Bicistronic) and T7 - LacOAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRY2olig-mCherry
Plasmid#60032PurposeExpresses a fusion of CRY2PHR E490G with mCherryDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
p5E-pth2
Plasmid#191428PurposeTol2 Gateway 5' entry vector containing 2067 bp upstream of the CDS for zebrafish pth2 (ENSDARG00000022951), including the 5' UTR and first intron (GRCz11 chr 17:33493999-33496066)DepositorInsertpth2 regulatory region (pth2 Zebrafish)
UseTol2 gateway 5' entry vectorAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fragment1 with TLS2
Plasmid#196983PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.DepositorInsertIntermediate fragment for assembly of gRNA-TLS2 construct
UseGateway-compatible entry vectorAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
B2094_CRY2olig-miRFP
Plasmid#215114PurposeExpresses CRY2olig (E490G CRY2 1-498) fused to miRFP in mammalian cellsDepositorInsertCRY2olig-miRFP (CRY2 Mustard Weed)
TagsmiRFPExpressionMammalianMutationE490GPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDBTrp-LexABD-CRY2FL
Plasmid#78210PurposeUse with Addgene 40615 for blue light transcription control in yeastDepositorInsertLexABD-CRY2 (CRY2 Mustard Weed)
TagslexA binding domainExpressionYeastMutationcontains endogenous CRY2 NLSPromoterADH1Available SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
attB-P7-attP-YFP
Plasmid#195571PurposeA strong P7 promoter flanked by Bxb1 recombination sites attB and attP. Downstream of attP is a strong RBS and YFP coding sequence.DepositorInsertPromoter flanked by Bxb1 recombination sites attB and attP with YFP downstream
UseSynthetic BiologyPromoterP7Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmHPat-del57-499-dsRNAres_J
Plasmid#146691PurposeInsect Expression of DmHPat-del57-499-dsRNAresDepositorInsertDmHPat-del57-499-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationone silent mutation A1758G compared to the sequen…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmHPat-dsRNAres_J
Plasmid#146692PurposeInsect Expression of DmHPat-dsRNAresDepositorInsertDmHPat-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationtwo non silent, A479V, G568D and one silent mutat…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat-del500-684-dsRNAres_H
Plasmid#146466PurposeInsect Expression of DmHPat-del500-684-dsRNAresDepositorInsertDmHPat-del500-684-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationtwo silent mutations compared to the sequence gi…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only