We narrowed to 6,598 results for: 272
-
Plasmid#127268PurposeFor in vitro translation of WT ELL2 with HA tag inserted near N-termDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationELL2mRNA+polyA with HA tag inserted at aa12 betwe…PromoterT7Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47K)
Plasmid#112723PurposeArg47 of TBP6.7 interacts with Hoogsteen edge of TAR's Gua26. Mutating this amino acid to Lys reduces binding to the WT TAR RNA ~330-fold.DepositorInsert6His-TEV-TBP6.7(R47K)
Tags6His-TEVExpressionBacterialMutationR47KPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48A)
Plasmid#112724PurposeGln48 contacts the backbone of TAR RNA as well as mediates intramoecular interaction to stabilize the conformation of beta2-beta3 loop within TBP6.7.DepositorInsert6His-TEV-TBP6.7(Q48A)
Tags6His-TEVExpressionBacterialMutationQ48APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(T50A)
Plasmid#112727PurposeLav-evolved amino acid T50 within TBPs is important in engaging intramolecularly to steer also lab-evolved R49 into conformation compatible binding to RNA.DepositorInsert6His-TEV-TBP6.7(T50A)
Tags6His-TEVExpressionBacterialMutationT50APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R52A)
Plasmid#112729Purpose52nd position is Arg in both wild-type U1A and TBPs, but the RNA recognition by this residue in both types of proteins is fundamentally different.DepositorInsert6His-TEV-TBP6.7(R52A)
Tags6His-TEVExpressionBacterialMutationR52APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyAvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgCTG
Plasmid#232723PurposeSpCas9 guide RNA targeting CAG repeats for C-to-T base editingDepositorInsertSpCas9 gRNA targeting CAG repeats
ExpressionMammalianAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgGAA
Plasmid#232724PurposeCas9 guide RNA targeting GAA repeats for A-to-G base editingDepositorInsertSpCas9 gRNA targeting GAA repeats
ExpressionMammalianAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NOD2-EGFP
Plasmid#131207Purposemammalian expression, tet RDepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
nAChR beta2 WT
Plasmid#24272DepositorInsertnAChR beta2 WT (Chrnb2 Mouse)
ExpressionMammalianAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
DRD5-Tango
Plasmid#66272PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMXS-hs-HMGA2
Plasmid#52727Purposeretroviral expression of human HMGA2DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBJG1 T7-8xHis-OGT K842M
Plasmid#154272PurposeBacterial expression of full length human OGT with K842M mutation (catalytically inactive). N-terminal T7_leader-8xHis tag followed by HRV3C protease site.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags8x His, HRV3C protease site, and T7 leaderExpressionBacterialMutationLysine 842 changed to Methionine- bacterial codon…Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ets2
Plasmid#70272PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-NRAS
Plasmid#52728Purposeretroviral expression of human NRASDepositorAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-NHL only-LIN-41
Plasmid#52723Purposeretroviral expression of human LIN-41 / TRIM71 containing only the NHL repeats and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationNHL-only contains only an initiating methionine a…Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-7CtoA-LIN-41
Plasmid#52726Purposeretroviral expression of human LIN-41 / TRIM71 containing cysteine to alanine point mutations of all 7 cysteines in the RING domain and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationchanged cysteines 12, 15, 61, 66, 69, 91, and 94 …Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only