We narrowed to 536 results for: PA-GFP
-
Plasmid#233270PurposeTo express GFP from a CMV promoter and to express and shRNA targeting Rat Npas4DepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CMV-GFP-pA U6 shRNA (Rat NPAS4 #5)
Plasmid#233271PurposeTo express GFP from a CMV promoter and to express and shRNA targeting Rat Npas4DepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat Nurr1 #1)
Plasmid#233273PurposeTo express GFP from a CMV promoter and to express an shRNA targeting Rat Nurr1DepositorInsertGFP and shRNA targeting Rat Nurr1 (Nr4a2 Rat)
UseAAVAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat Nurr1 #5)
Plasmid#233274PurposeTo express GFP from a CMV promoter and to express an shRNA targeting Rat Nurr1DepositorInsertGFP and shRNA targeting Rat Nurr1 (Nr4a2 Rat)
UseAAVAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6
Plasmid#192789PurposeaGFP nanobody minimizer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody minimizer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pet21a-aGFPnb-enhancer-cys-linker-YbbR-(PAS)5-H6
Plasmid#192788PurposeaGFP nanobody enhancer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody enhancer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
Plasmid#91802PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Lyn-EGFP
Plasmid#196875PurposeNeuron-specific expression of LynGFP reporterDepositorInsertLynEGFP
UseCre/LoxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS-1 (perf)
Plasmid#40836PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–perf
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-2 (mm21)
Plasmid#40837PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-rtTA-IRES-nls-EGFP-WPRE-bGH-pA (JDW 410)
Plasmid#229807PurposeA CAGGS driven tet-on transactivator with an nls-EGFP reporterDepositorInsertrtTA-IRES-nls-EGFP
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti EFS-GFP-pa (opposite orientation)- TRE3g-Flag-GluN2B-WPRE
Plasmid#233047PurposeTo express GFP from an EFS promoter in the 3'-5' direction and Flag-GluN2B from a TRE3g promoter in the 5'-3' directionDepositorInsertGFP and GluN2B
UseLentiviralTagsFlag and GFPAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only