We narrowed to 8,931 results for: Pol
-
Plasmid#114604PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
UseTagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…PromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P90C
Plasmid#114603PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
UseTagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…PromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationCterm_Nterm_switchedPromoterAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156434PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationAll zinc fingers mutatedPromoterAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIS-MDH1-HIS
Plasmid#184558PurposeBacterial expression of human MDH1 with HIS TagDepositorInsertMalate dehydrogenase 1 (MDH1 Human)
UseTags6xHISExpressionBacterialMutationPromoterAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156429PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationDELTA1-265PromoterAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
US0 pyrF-/hisB-/tnaA-
Bacterial Strain#228512PurposeIndole-responsive Growth SelectionDepositorBacterial ResistanceTetracyclineAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#156432PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationnonePromoterAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BKV ER
Plasmid#37864DepositorUseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPKGAvailable sinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
DH10beta F' DOT sbcC (donor strain)
Bacterial Strain#12082DepositorBacterial ResistanceTetracyclineAvailable sinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianMutationPromoterCMVAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…PromoterAvailable sinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_1_001
Plasmid#167347PurposeddPCR gating control for droplets containing all 5 targets (2 in pol)DepositorInsertpol_gag_tat_env
UseOtherTagsExpressionMutationPromoterAvailable sinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-F-ELL2
Plasmid#49422PurposeMammalian expression of flag-tagged human ELL2DepositorInsertELL2 (ELL2 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only