We narrowed to 10,372 results for: EPO
-
Plasmid#227137PurposeBarcoded assay, MAPK sensor; barcode BC0136DepositorInsertEGR1 promoter driving barcode 0136 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHPHS927
Plasmid#228238PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible β-globin reporter for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
Beta globin
Tags3xFLAG, HA, and PuroRExpressionMammalianPromoterTRE3GV and noneAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC0132-luc2
Plasmid#227136PurposeBarcoded assay, MAPK sensor; barcode BC0132DepositorInsertEGR1 promoter driving barcode 0132 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426
Plasmid#226734PurposeExpresses a reporter for an alpha-helical OMM proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p40651-EFSNS-FMR1_e1-24xms2
Plasmid#222968PurposeMS2 mRNA reporter with intact FMR1 5' UTR and exon 1 sequenceDepositorInsertFMR1-31CGG 5' UTR and exon1
ExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only