We narrowed to 8,472 results for: chloramphenicol
-
Plasmid#208409PurposeLentivirus compatible with LR Gateway cloning for UBC-driven gene expression with CMV-RFP in backboneDepositorArticleTypeEmpty backboneUseLentiviral; Gateway: dest vectorPromoterUBCAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only
-
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2-3a_004_atpA_Promoter+5'UTR_Cr
Plasmid#235876PurposeatpA promoter + 5'UTR Chlamydomonas reinhardtii 2-3aDepositorInsertatpA promoter + 5'UTR
UseSynthetic BiologyAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_G_0_2-3_005_Promoter+5'UTR_Placeholder
Plasmid#235870PurposeEncodes a sfGFP cassette in the promoter+5'UTR position used for placeholder cloningDepositorInsertPromoter + 5'UTR placeholder
UseSynthetic BiologyMutationnoneAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-chKlacRS-WT
Plasmid#232159PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.DepositorInsertchKlacRS-WT
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-chKlacRS-IPYE
Plasmid#232160PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.DepositorInsertchKlacRS-IPYE
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_010_psbD_5'Hom_Cr
Plasmid#235788Purpose5' Homology psbD in the M1 position used for genome integration at the psbD locusDepositorInsert5' Homology region of the psbD locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_1_005_rbcL_5'Hom_Cr
Plasmid#235786Purpose5' Homology rbcL in the M1 position used for genome integration at the rbcL locusDepositorInsert5' Homology region of the rbcL locus of Chlamydomonas reinhardtii chloroplast CC-125
UseSynthetic BiologyMutationnoneAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2-3a_002_psbD_Promoter+5'UTR_Cr
Plasmid#235874PurposepsbD promoter + 5'UTR Chlamydomonas reinhardtii 2-3aDepositorInsertpsbD promoter + 5'UTR
UseSynthetic BiologyAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only