We narrowed to 44,479 results for: gats
-
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXI3
Plasmid#101518PurposeDonor Vector containing FOXI3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXI3 (FOXI3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ASCL3
Plasmid#101515PurposeDonor Vector containing ASCL3 transcription factor, part of the Human TFome CollectionDepositorInsertASCL3 (ASCL3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXB3
Plasmid#101478PurposeDonor Vector containing HOXB3 transcription factor, part of the Human TFome CollectionDepositorInsertHOXB3 (HOXB3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE1
Plasmid#101439PurposeDonor Vector containing FOXE1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE1 (FOXE1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE3
Plasmid#101429PurposeDonor Vector containing FOXE3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE3 (FOXE3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXH1
Plasmid#101431PurposeDonor Vector containing FOXH1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXH1 (FOXH1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-BSX
Plasmid#101410PurposeDonor Vector containing BSX transcription factor, part of the Human TFome CollectionDepositorInsertBSX (BSX Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXB9
Plasmid#101398PurposeDonor Vector containing HOXB9 transcription factor, part of the Human TFome CollectionDepositorInsertHOXB9 (HOXB9 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only