We narrowed to 2,396 results for: ncl
-
Plasmid#164639PurposeBacterial expression plasmid for His6-MEK1C218DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S218C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(2xlumen)-WPRE-UbC-Emerald
Plasmid#225956PurposeLentiviral vector plasmid expressing human CKAP4 mutant with an additional luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationFull-length CKAP4 with additional luminal domain …PromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL1-WPRE-UbC-Emerald
Plasmid#225944PurposeLentiviral vector plasmid expressing human atlastin GTPase 1 (ATL1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC8B1_STOP
Plasmid#161364PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC8B1 (SLC8B1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
MEK1C218C222
Plasmid#164640PurposeBacterial expression plasmid for His6-MEK1C218C222DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S218C/S222C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only