We narrowed to 19,011 results for: REV

#222430

FRET-based reporter for monitoring deltaPKC activity at the nucleus in cells.

Alexandra Newton

Kajimoto et al J Biol Chem. 2010 Dec 31. 285(53):41896-

Nov. 21, 2024

Academic Institutions and Nonprofits only

#227645

pTet-driven expression of F30-scaffolded Pepper aptamer and mTurquoise2 for quantifying cell-free RNA and protein synthesis. The mTurq2 has a GGGGS linker followed by a His6x tag.

Richard Murray

Kapasiawala et al bioRxiv 2023.03.22.533877

Nov. 14, 2024

Academic Institutions and Nonprofits only

#226348

Expression of yeast Rpn10 with the UIM deleted

Andreas Martin

Jonsson et al Sci Adv. 2022 Dec 23;8(51):eadd9520. doi

Nov. 13, 2024

Academic Institutions and Nonprofits only

#222428

FRET-based reporter for monitoring deltaPKC activity at the Golgi in cells.

Alexandra Newton

Kajimoto et al J Biol Chem. 2010 Dec 31. 285(53):41896-

Nov. 4, 2024

Academic Institutions and Nonprofits only

#226273

Plasmid expressing the SEC22 allele from NCYC110, under control of its native promoter

Jolanda Van Leeuwen

Paltenghi et al G3 (Bethesda). 2025 Mar 3:jkaf047. doi:

Oct. 30, 2024

Academic Institutions and Nonprofits only

#226271

Plasmid expressing the SEC22 allele from L-1374, under control of its native promoter

Jolanda Van Leeuwen

Paltenghi et al G3 (Bethesda). 2025 Mar 3:jkaf047. doi:

Oct. 30, 2024

Academic Institutions and Nonprofits only

#226272

Plasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoter

Jolanda Van Leeuwen

Paltenghi et al G3 (Bethesda). 2025 Mar 3:jkaf047. doi:

Oct. 30, 2024

Academic Institutions and Nonprofits only

#226270

Plasmid expressing the SEC22 allele from S288C, under control of its native promoter

Jolanda Van Leeuwen

Paltenghi et al G3 (Bethesda). 2025 Mar 3:jkaf047. doi:

Oct. 30, 2024

Academic Institutions and Nonprofits only

#226264

Plasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 gene

Jolanda Van Leeuwen

Paltenghi et al G3 (Bethesda). 2025 Mar 3:jkaf047. doi:

Oct. 28, 2024

Academic Institutions and Nonprofits only

#226279

Plasmid expressing the SSD1 allele from NCYC110, under control of its native promoter

Jolanda Van Leeuwen

Paltenghi et al G3 (Bethesda). 2025 Mar 3:jkaf047. doi:

Oct. 28, 2024

Academic Institutions and Nonprofits only