We narrowed to 2,484 results for: PAM
-
Plasmid#22922DepositorAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pET32a-HD39Q
Plasmid#11514DepositorInserthuntingtin, exon 1, 39 glutamines (HTT Human)
TagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 39 glutamines, vector m…Available SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral Prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-TfR
Plasmid#12130DepositorInserttransferrin receptor (TFRC Human)
Tags6X-His tag, Factor Xa cleavage site, and leader p…ExpressionInsectMutationThe portion of the human TfR gene encoding residu…Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPS808
Plasmid#8856DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPS809
Plasmid#8935DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPS810
Plasmid#8936DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Yeast GoldenBraid Cloning System and Toolkit
Plasmid Kit#1000000138PurposeModular cloning system for generation of high expression transcriptional units; Integrates in yeast (S. cerevisiae) genome at two different loci supporting high and stable transgene expressionDepositorAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
p35S:TN3-YFPn
Plasmid#102407Purposesplit YFP. Plant expression of p35S:TN3-YFPnDepositorInsertTN3
TagsYFPnExpressionPlantPromoter35SAvailable SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hDAT
Plasmid#32810DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry1-Lifeact-7
Plasmid#54492PurposeLocalization: Actin, Excitation: 400 / 504, Emission: 515 / 517DepositorInsertLifeact-PAmCherry1
ExpressionMammalianAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
OTV-dDAT
Plasmid#32812DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
R777-E269 Hs.RASSF9
Plasmid#70553PurposeGateway ORF clone of human RASSF9 [NM_005447.3] with stop codon (for native or N-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E270 Hs.RASSF9-nostop
Plasmid#70554PurposeGateway ORF clone of human RASSF9 [NM_005447.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only