We narrowed to 1,984 results for: rpe
-
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_1k)-PGKpuro2ABFP-W
Plasmid#208418PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_2b)-PGKpuro2ABFP-W
Plasmid#208419PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_1k)-PGKpuro2ABFP-W
Plasmid#208422PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_2b)-PGKpuro2ABFP-W
Plasmid#208423PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hTNF_2b)-PGKpuro2ABFP-W
Plasmid#208426PurposeLentiviral gRNA plasmid targeting human TNF gene, co-expression of BFP tagDepositorInsertTNF (TNF Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_1k)-PGKpuro2ABFP-W
Plasmid#208412PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_2m)-PGKpuro2ABFP-W
Plasmid#208413PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Control-TP53-LRG-GFP
Plasmid#225874PurposeGuides targeting P53 and a control sequenceDepositorInsertControl and TP53 (TP53 Human)
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Control-RB1-LRG-GFP
Plasmid#225875PurposeGuides targeting RB1 and a control sequenceDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pb-NES-ZapCV5 (cpV143)
Plasmid#112061PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Low affinity to free zinc (Kd ~ 300nM, n = 0.55) due to mutation of the zinc binding Cys residues to His.DepositorInsertNES-ZapCV5
TagsNuclear Export Signal (NES) derived from HIV-1ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…PromoterCBAAvailable SinceJuly 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-JAK1
Plasmid#174572PurposeHuman FLAG-tagged JAK1 expression (N-term. tag) (CMV prom.)DepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#130909PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CAG promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorHas ServiceAAV8InsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX313-TP53-WT
Plasmid#118014PurposeConstitutive expression of wild-type human Tumor Protein p53 (TP53)DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato]
Plasmid#62723PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. TdTomato is a codon diversified version.DepositorHas ServiceAAV1 and AAV5InsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4-PSMA5-PSMA6-PSMA7
Plasmid#214138PurposeInsect cell expression of human 20S CP alpha-subunitsDepositorInsertsExpressionInsectPromoterpolyhedrinAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Chronos-tdTomato]
Plasmid#84481PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTAHR TH-p2a-TD:Tomato (floxed selection Puro)
Plasmid#135814PurposeFluorescent reporter for knock-in of TdTomato into the TH locusDepositorInsertTH-p2a-TD:Tomato (red fluorophore protein) construct as a reporter for TH expression. (TH Human)
Tagsp2a-TdTomatoExpressionMammalianAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-ChrimsonR-tdTomato
Plasmid#122064PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α promoter (1.1kb short version).tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1a(1.1kb short version)Available SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only