We narrowed to 10,397 results for: EPO;
-
Plasmid#99313PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIS1-mutant RhoA 3'UTR
Plasmid#26090DepositorInsertmutant RhoA 3'UTR (RHOA Human)
UseLuciferaseExpressionMammalianMutationBoth miR-31 binding sites in 3’ UTR mutagenized. …Available SinceOct. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom285bp-pGL4.10Luc
Plasmid#60873PurposeLuc reporter driven by 285 bp of the CIP2A promoterDepositorInsert285 bp promoter fragment of Cancerous Inhibitor of PP2A2 (CIP2A Human)
UseLuciferase; PromoterlessAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1210
Plasmid#29107PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
huCofilin K22Q SSR-mRFP
Plasmid#252617PurposeExpresses shRNA resistant human cofilin with K22Q mutation that reduces nuclear uptake and serves as a cofilactin rod reporterDepositorInsertcofilin 1 (CFL1 Human)
TagsmRFPExpressionMammalianMutationK22Q; silent mutations at nt 67 to 75 in which TC…PromoterCMVAvailable SinceMarch 5, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-TRE3G-CytoTape-FLAG
Plasmid#252514PurposeTimestamp monomer based on CytoTape for encoding time along protein tape recorder for mouse brain in vivo applicationsDepositorInsertCytoTape-FLAG
UseAAVExpressionMammalianPromoterTRE3GAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only