We narrowed to 2,370 results for: fas
-
Plasmid#73833PurposeExpress human Plekhm1 (PH1 domain) in bacterial cellsDepositorInsertPlekhm1 (PLEKHM1 Human)
TagsGstExpressionBacterialMutationto vector was cloned PH1 domain of human Plekhm1…Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plekhm1 -C101 pGEX 4T2-GST
Plasmid#73832PurposeExpress human Plekhm1 (S956 to end domain) in bacterial cellsDepositorInsertPlekhm1 (PLEKHM1 Human)
TagsGstExpressionBacterialMutationto vector was cloned 101 aa from human Plekhm1 (S…Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNB695
Plasmid#60144PurposeDisintegrator plasmid encoding MET17 promoter driven green beetle luciferase with nuclear localization signal (NLS) and ClpXP degron tag (ssrA).DepositorInsertGrLuc
TagsClpXP degron and Nuclear localization signal (NLS…ExpressionYeastPromoterMET17prAvailable SinceDec. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNB697
Plasmid#60146PurposeDisintegrator plasmid encoding MET17 promoter driven red beetle luciferase with nuclear localization signal (NLS) and ClpXP degron tag (ssrA).DepositorInsertRdLuc
TagsClpXP degron and Nuclear localization signal (NLS…ExpressionYeastPromoterMET17prAvailable SinceDec. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUAST td tomato Rab35 CA
Plasmid#58383Purposeexpression of drosophila tdtomato-Rab35 constitutively active mutantDepositorInsertRab35 (Rab35 Fly)
Tagstd tomatoExpressionInsectMutationQ67L (constitutive active)PromoterGAL4Available SinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUAST YFP mouse Rab35 CA
Plasmid#46015DepositorInsertRab35 (Rab35 Mouse)
UseDrosophilaTagsYFPExpressionInsectMutationQ67L (constitutively active)PromoterGAL4Available SinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATG16L1 HRD
Plasmid#207537PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG16L1 locus in human cellsDepositorInsertHaloTag with internal PuroR cassette flanked by human ATG16L1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-TCAB1 HRD
Plasmid#207535PurposeHomologous recombination donor to insert HaloTag at the N-terminus of the endogenous TCAB1 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human TCAB1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATM-Halo HRD
Plasmid#207082PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous ATM locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP1muA single guide RNA
Plasmid#230030Purposeguide RNA for AP1muA tagging at the C-terminus in pX459DepositorInsertAP1M1 guide (AP1M1 Human)
UseCRISPRAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168-Halo HRD
Plasmid#207080PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF168 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
ExpressionMammalianPromoterNoneAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-LIC_GRWD1:1-446
Plasmid#210876PurposeInsect expression of full-length human GRWD1. N-terminal 6X His tag with thrombin protease cleavage site.DepositorInsertGRWD1:M1-V446 (GRWD1 Human)
TagsMGSSHHHHHHSSGLVPRGSExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Hook3(1-522)-GFP-Psc-StrepII
Plasmid#111861PurposeC-terminal GFP tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal GFP-Psc-StrepII tag.DepositorInsertHook3(1-552)-GFP (HOOK3 Human)
TagsGFP, Psc tag, and Strep tagExpressionInsectMutationOptimised for expression in SF9 cellsAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-hSyntenin2b
Plasmid#89422PurposeTwo-hybrid systemDepositorAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-crab-eating macaque cGASdeltaN-HA
Plasmid#186870PurposeDoxycycline-dependent expression of crab-eating macaque cGAS gene in mammalian cells by retroviral transductionDepositorInsertCrab-eating macaque cGAS truncation mutant (160-522 a.a.) with C-terminal HA tag (CGAS Macaca fascicularis, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL_SEC31A:1-338
Plasmid#210925PurposeInsect expression of human SEC31A fragment M1 to T338. N-terminal 6X His tag with TEV cleavage.DepositorInsertSEC31A:M1-T338 (SEC31A Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBD-BirA_RFWD3:425-774
Plasmid#210884PurposeInsect expression of human RFWD3 fragment S425 to E774. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertRFWD3:S425-E774 (RFWD3 Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUAST YFP Rab18 DN
Plasmid#58722Purposeexpression of drosophila YFP Rab18 dominant negative mutantDepositorAvailable SinceSept. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSems StayGold-2xFYVE
Plasmid#222948PurposeExpression of HRS 2xFYVE tagged with StayGold in mammalian cellsDepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only