We narrowed to 55,781 results for: plasmid
-
-
pSBtet-RB-PE2
Plasmid#173903PurposeSB-transposon with inducible expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE-CMV-Rheb(D60I)-IRES-eGFP-W
Plasmid#32521DepositorInsertDominant negative Rheb (D60I) (Rheb Rat)
UseLentiviralExpressionMammalianMutationD60I to make dominant negativePromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5-donor
Plasmid#112303PurposeCRISPR donor plasmid to tag human transcription factor ZBTB5 with GFPDepositorInsertZBTB5 homology arms flanking EGFP-IRES-Neo cassette (ZBTB5 Human)
UseCRISPRAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.ChETA(E123T/H134R)-eYFP.WPRE.hGH
Plasmid#100049PurposeAAV expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by hSynap promoter for optogenetic activationDepositorHas ServiceAAV9InserthChR2(E123T/H134R)
UseAAVTagsEYFPExpressionMammalianMutationhumanized, E123T/H134RPromoterhSynapAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS ZfHoxb1a
Plasmid#27519DepositorInsertHoxb1a (hoxb1a Zebrafish)
UseRiboprobe synthesisAvailable SinceFeb. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
SPIN3A
Plasmid#74656PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS ZfHoxa2b
Plasmid#27514DepositorInsertHoxa2b (hoxa2b Zebrafish)
UseRiboprobe synthesisAvailable SinceFeb. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
psicheck_NDUFA6_3UTR
Plasmid#65886PurposeLuciferase assay vector, assessing regulation of NDUFA6 3' UTRDepositorInsertNDUFA6 (NDUFA6 Human)
ExpressionMammalianAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS ZfHoxc6a
Plasmid#27541DepositorInsertHoxc6a (hoxc6a Zebrafish)
UseCloning vectorAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAG AAV CMV C-HA
Plasmid#242962PurposeEmpty AAV expression backbone with C-terminal HA tagDepositorTypeEmpty backboneUseAAVTagsHAPromoterCMVAvailable SinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG AAV CMV N-HA
Plasmid#242960PurposeEmpty AAV expression backbone with N-terminal HA tagDepositorTypeEmpty backboneUseAAVTagsHAPromoterCMVAvailable SinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCODE-3
Plasmid#247475PurposePlasmid for inducible expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operon, tRNA flanking regio…PromoterpTetAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G1B3-GFP-WPRE-miR124T-SYNpolyA
Plasmid#245081PurposeFluorescent reporter gene, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP
UseAAVExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tre3G-Flag-Rat Arc-Arc 3' UTR
Plasmid#233054PurposeTo express Flag-tagged Rat Arc from a TRE3g promoter. The Arc gene contains the Rat Arc 3'UTR containing NO intronsDepositorInsertRat Arc
UseAAVTagsFlagAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS1_NSP13_BV_NBIO-TEV_CTHROM-his
Plasmid#234382PurposeBaculovirus expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp13_SARS
UseBaculovirus expresssionTagsLVPRGSGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGPromoterPolyhedrinAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only