We narrowed to 1,966 results for: rigi
-
Plasmid#110981PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium membrane protein (PF3D7_1434400 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0929900-COMP-blac-flag-his
Plasmid#110980PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_0929900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0511400-COMP-blac-flag-his
Plasmid#110974PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_0511400 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1333300-COMP-blac-flag-his
Plasmid#110972PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInserttransmembrane protein Tmp21 homologue, putative (PF3D7_1333300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1462300-COMP-blac-flag-his
Plasmid#110970PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_1462300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1352500-COMP-blac-flag-his
Plasmid#110969PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertthioredoxin-related protein, putative (PF3D7_1352500 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0912400-COMP-blac-flag-his
Plasmid#110966PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertalkaline phosphatase, putative (PF3D7_0912400 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIESP15-COMP-blac-flag-his
Plasmid#110958PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertparasite-infected erythrocyte surface protein (PIESP15) (PF3D7_0103900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1105300-COMP-blac-flag-his
Plasmid#110960PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein, unknown function (PF3D7_1105300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPi Kit
Plasmid Kit#1000000136PurposePlasmids for performing CRISPR/Cas9 mediated gene and genome editing in Pichia pastoris.DepositorApplicationGenome EditingVector TypeYeast ExpressionEditing TypeCRISPRAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
GoldenPiCS Kit
Plasmid Kit#1000000133PurposeA flexible modular system for advanced strain engineering in Pichia pastoris to accomplish pathway expression, protein production, or other DNA integration applications.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeYeast ExpressionCloning TypeGolden GateAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Antibody#251722-rAbPurposeAnti-Slit-2 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse Slit-2. Not expected to cross-react with other Slits.DepositorArticleRecommended ApplicationsImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 13, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#219609-rAbPurposeAnti-Neurexin-3a (mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for mouse NRXN3a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistryReactivityMouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237797-rAbPurposeAnti-Neurexin-1a (human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN1a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistry and ImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237802-rAbPurposeAnti-Neurexin-1a (mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN1a. Weak cross-reactivity to other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237808-rAbPurposeAnti-Neurexin-2a (mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN2a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237806-rAbPurposeAnti-Neurexin-2a (mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains. Shows strong binding to human and mouse NRXN2a, and weak cross-reactivity with other NRXNsDepositorArticleRecommended ApplicationsImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits